ID: 1049439281

View in Genome Browser
Species Human (GRCh38)
Location 8:142601833-142601855
Sequence CTCAACAGCTGTGCACGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049439273_1049439281 7 Left 1049439273 8:142601803-142601825 CCCAGGGAGGGGCAGCCTGCTGC No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data
1049439265_1049439281 22 Left 1049439265 8:142601788-142601810 CCCGGGACCTGGGCCCCCAGGGA No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data
1049439271_1049439281 9 Left 1049439271 8:142601801-142601823 CCCCCAGGGAGGGGCAGCCTGCT No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data
1049439276_1049439281 -8 Left 1049439276 8:142601818-142601840 CCTGCTGCGGCACCCCTCAACAG No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data
1049439274_1049439281 6 Left 1049439274 8:142601804-142601826 CCAGGGAGGGGCAGCCTGCTGCG No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data
1049439270_1049439281 15 Left 1049439270 8:142601795-142601817 CCTGGGCCCCCAGGGAGGGGCAG No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data
1049439266_1049439281 21 Left 1049439266 8:142601789-142601811 CCGGGACCTGGGCCCCCAGGGAG No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data
1049439272_1049439281 8 Left 1049439272 8:142601802-142601824 CCCCAGGGAGGGGCAGCCTGCTG No data
Right 1049439281 8:142601833-142601855 CTCAACAGCTGTGCACGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049439281 Original CRISPR CTCAACAGCTGTGCACGAGA GGG Intergenic
No off target data available for this crispr