ID: 1049439286

View in Genome Browser
Species Human (GRCh38)
Location 8:142601854-142601876
Sequence GGACGCTGCCAGGGAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049439278_1049439286 0 Left 1049439278 8:142601831-142601853 CCCTCAACAGCTGTGCACGAGAG No data
Right 1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG No data
1049439272_1049439286 29 Left 1049439272 8:142601802-142601824 CCCCAGGGAGGGGCAGCCTGCTG No data
Right 1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG No data
1049439273_1049439286 28 Left 1049439273 8:142601803-142601825 CCCAGGGAGGGGCAGCCTGCTGC No data
Right 1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG No data
1049439276_1049439286 13 Left 1049439276 8:142601818-142601840 CCTGCTGCGGCACCCCTCAACAG No data
Right 1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG No data
1049439271_1049439286 30 Left 1049439271 8:142601801-142601823 CCCCCAGGGAGGGGCAGCCTGCT No data
Right 1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG No data
1049439279_1049439286 -1 Left 1049439279 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
Right 1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG No data
1049439277_1049439286 1 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG No data
1049439274_1049439286 27 Left 1049439274 8:142601804-142601826 CCAGGGAGGGGCAGCCTGCTGCG No data
Right 1049439286 8:142601854-142601876 GGACGCTGCCAGGGAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049439286 Original CRISPR GGACGCTGCCAGGGAGGGAC AGG Intergenic
No off target data available for this crispr