ID: 1049439288

View in Genome Browser
Species Human (GRCh38)
Location 8:142601860-142601882
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049439276_1049439288 19 Left 1049439276 8:142601818-142601840 CCTGCTGCGGCACCCCTCAACAG No data
Right 1049439288 8:142601860-142601882 TGCCAGGGAGGGACAGGTGTGGG No data
1049439278_1049439288 6 Left 1049439278 8:142601831-142601853 CCCTCAACAGCTGTGCACGAGAG No data
Right 1049439288 8:142601860-142601882 TGCCAGGGAGGGACAGGTGTGGG No data
1049439277_1049439288 7 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439288 8:142601860-142601882 TGCCAGGGAGGGACAGGTGTGGG No data
1049439279_1049439288 5 Left 1049439279 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
Right 1049439288 8:142601860-142601882 TGCCAGGGAGGGACAGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049439288 Original CRISPR TGCCAGGGAGGGACAGGTGT GGG Intergenic