ID: 1049439289

View in Genome Browser
Species Human (GRCh38)
Location 8:142601861-142601883
Sequence GCCAGGGAGGGACAGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049439276_1049439289 20 Left 1049439276 8:142601818-142601840 CCTGCTGCGGCACCCCTCAACAG No data
Right 1049439289 8:142601861-142601883 GCCAGGGAGGGACAGGTGTGGGG No data
1049439279_1049439289 6 Left 1049439279 8:142601832-142601854 CCTCAACAGCTGTGCACGAGAGG No data
Right 1049439289 8:142601861-142601883 GCCAGGGAGGGACAGGTGTGGGG No data
1049439278_1049439289 7 Left 1049439278 8:142601831-142601853 CCCTCAACAGCTGTGCACGAGAG No data
Right 1049439289 8:142601861-142601883 GCCAGGGAGGGACAGGTGTGGGG No data
1049439277_1049439289 8 Left 1049439277 8:142601830-142601852 CCCCTCAACAGCTGTGCACGAGA No data
Right 1049439289 8:142601861-142601883 GCCAGGGAGGGACAGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049439289 Original CRISPR GCCAGGGAGGGACAGGTGTG GGG Intergenic