ID: 1049442014

View in Genome Browser
Species Human (GRCh38)
Location 8:142613884-142613906
Sequence GGCGGTCGGCCCAGCGCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049442004_1049442014 7 Left 1049442004 8:142613854-142613876 CCACCGGGTACTTGCCGCCCGTG 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1049442014 8:142613884-142613906 GGCGGTCGGCCCAGCGCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
1049442003_1049442014 8 Left 1049442003 8:142613853-142613875 CCCACCGGGTACTTGCCGCCCGT 0: 1
1: 0
2: 0
3: 1
4: 9
Right 1049442014 8:142613884-142613906 GGCGGTCGGCCCAGCGCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
1049442009_1049442014 -7 Left 1049442009 8:142613868-142613890 CCGCCCGTGGACTCCAGGCGGTC 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1049442014 8:142613884-142613906 GGCGGTCGGCCCAGCGCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
1049442006_1049442014 4 Left 1049442006 8:142613857-142613879 CCGGGTACTTGCCGCCCGTGGAC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1049442014 8:142613884-142613906 GGCGGTCGGCCCAGCGCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116
1049442011_1049442014 -10 Left 1049442011 8:142613871-142613893 CCCGTGGACTCCAGGCGGTCGGC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1049442014 8:142613884-142613906 GGCGGTCGGCCCAGCGCTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049442014 Original CRISPR GGCGGTCGGCCCAGCGCTCC AGG Exonic