ID: 1049442303

View in Genome Browser
Species Human (GRCh38)
Location 8:142614940-142614962
Sequence AGCTGCACATCCTGCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049442303_1049442314 20 Left 1049442303 8:142614940-142614962 CCAGCTCTGCAGGATGTGCAGCT No data
Right 1049442314 8:142614983-142615005 CCATCAGCCTCTGTGCCCAGGGG No data
1049442303_1049442312 19 Left 1049442303 8:142614940-142614962 CCAGCTCTGCAGGATGTGCAGCT No data
Right 1049442312 8:142614982-142615004 ACCATCAGCCTCTGTGCCCAGGG No data
1049442303_1049442311 18 Left 1049442303 8:142614940-142614962 CCAGCTCTGCAGGATGTGCAGCT No data
Right 1049442311 8:142614981-142615003 CACCATCAGCCTCTGTGCCCAGG No data
1049442303_1049442306 -10 Left 1049442303 8:142614940-142614962 CCAGCTCTGCAGGATGTGCAGCT No data
Right 1049442306 8:142614953-142614975 ATGTGCAGCTGAGCCCGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049442303 Original CRISPR AGCTGCACATCCTGCAGAGC TGG (reversed) Intergenic
No off target data available for this crispr