ID: 1049443026

View in Genome Browser
Species Human (GRCh38)
Location 8:142617791-142617813
Sequence GAGATCAGCAGGGCCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049443026_1049443035 8 Left 1049443026 8:142617791-142617813 CCCAGGCTGGCCCTGCTGATCTC No data
Right 1049443035 8:142617822-142617844 GCAGTTAGCGCTGCTCAGCAGGG No data
1049443026_1049443036 13 Left 1049443026 8:142617791-142617813 CCCAGGCTGGCCCTGCTGATCTC No data
Right 1049443036 8:142617827-142617849 TAGCGCTGCTCAGCAGGGAGAGG No data
1049443026_1049443034 7 Left 1049443026 8:142617791-142617813 CCCAGGCTGGCCCTGCTGATCTC No data
Right 1049443034 8:142617821-142617843 GGCAGTTAGCGCTGCTCAGCAGG No data
1049443026_1049443037 23 Left 1049443026 8:142617791-142617813 CCCAGGCTGGCCCTGCTGATCTC No data
Right 1049443037 8:142617837-142617859 CAGCAGGGAGAGGCAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049443026 Original CRISPR GAGATCAGCAGGGCCAGCCT GGG (reversed) Intergenic
No off target data available for this crispr