ID: 1049443748

View in Genome Browser
Species Human (GRCh38)
Location 8:142620662-142620684
Sequence CTGTCTCCCCATGTGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049443748_1049443757 18 Left 1049443748 8:142620662-142620684 CCTGGGTGCACATGGGGAGACAG No data
Right 1049443757 8:142620703-142620725 CAGGCGGGGCTGAGCTCAGGAGG No data
1049443748_1049443751 -10 Left 1049443748 8:142620662-142620684 CCTGGGTGCACATGGGGAGACAG No data
Right 1049443751 8:142620675-142620697 GGGGAGACAGGTGTGCTGGCAGG No data
1049443748_1049443756 15 Left 1049443748 8:142620662-142620684 CCTGGGTGCACATGGGGAGACAG No data
Right 1049443756 8:142620700-142620722 CAGCAGGCGGGGCTGAGCTCAGG No data
1049443748_1049443753 2 Left 1049443748 8:142620662-142620684 CCTGGGTGCACATGGGGAGACAG No data
Right 1049443753 8:142620687-142620709 GTGCTGGCAGGAACAGCAGGCGG No data
1049443748_1049443752 -1 Left 1049443748 8:142620662-142620684 CCTGGGTGCACATGGGGAGACAG No data
Right 1049443752 8:142620684-142620706 GGTGTGCTGGCAGGAACAGCAGG No data
1049443748_1049443754 3 Left 1049443748 8:142620662-142620684 CCTGGGTGCACATGGGGAGACAG No data
Right 1049443754 8:142620688-142620710 TGCTGGCAGGAACAGCAGGCGGG No data
1049443748_1049443755 4 Left 1049443748 8:142620662-142620684 CCTGGGTGCACATGGGGAGACAG No data
Right 1049443755 8:142620689-142620711 GCTGGCAGGAACAGCAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049443748 Original CRISPR CTGTCTCCCCATGTGCACCC AGG (reversed) Intergenic
No off target data available for this crispr