ID: 1049445143

View in Genome Browser
Species Human (GRCh38)
Location 8:142626671-142626693
Sequence AAGTGGCAAGCACTGTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049445143_1049445153 24 Left 1049445143 8:142626671-142626693 CCACACCACAGTGCTTGCCACTT No data
Right 1049445153 8:142626718-142626740 TATGTGAGCACCCCAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049445143 Original CRISPR AAGTGGCAAGCACTGTGGTG TGG (reversed) Intergenic
No off target data available for this crispr