ID: 1049445953

View in Genome Browser
Species Human (GRCh38)
Location 8:142631645-142631667
Sequence CATTGTATGCTCTCCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049445953_1049445959 6 Left 1049445953 8:142631645-142631667 CCCTGGAAGGAGAGCATACAATG No data
Right 1049445959 8:142631674-142631696 TTTGTTCAAGAGCTTTACTAAGG No data
1049445953_1049445961 18 Left 1049445953 8:142631645-142631667 CCCTGGAAGGAGAGCATACAATG No data
Right 1049445961 8:142631686-142631708 CTTTACTAAGGGAGTCTCTCAGG No data
1049445953_1049445960 7 Left 1049445953 8:142631645-142631667 CCCTGGAAGGAGAGCATACAATG No data
Right 1049445960 8:142631675-142631697 TTGTTCAAGAGCTTTACTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049445953 Original CRISPR CATTGTATGCTCTCCTTCCA GGG (reversed) Intergenic