ID: 1049445965

View in Genome Browser
Species Human (GRCh38)
Location 8:142631705-142631727
Sequence CAGGAGAAGCAGAACCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049445958_1049445965 11 Left 1049445958 8:142631671-142631693 CCTTTTGTTCAAGAGCTTTACTA No data
Right 1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049445965 Original CRISPR CAGGAGAAGCAGAACCGGGA GGG Intergenic
No off target data available for this crispr