ID: 1049447849

View in Genome Browser
Species Human (GRCh38)
Location 8:142639651-142639673
Sequence GTGGAGCAGCAGACTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049447840_1049447849 28 Left 1049447840 8:142639600-142639622 CCTATAGATTTATGTCTACAGCT No data
Right 1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG No data
1049447844_1049447849 -10 Left 1049447844 8:142639638-142639660 CCCAGCGCTCATGGTGGAGCAGC No data
Right 1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049447849 Original CRISPR GTGGAGCAGCAGACTGGGGA TGG Intergenic
No off target data available for this crispr