ID: 1049451801

View in Genome Browser
Species Human (GRCh38)
Location 8:142666023-142666045
Sequence CGGCTGCCGGGAAGAGCAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 174}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049451801_1049451813 -2 Left 1049451801 8:142666023-142666045 CCCTCTGCTCTTCCCGGCAGCCG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1049451813 8:142666044-142666066 CGGCTTGGAGGCCATGGGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 281
1049451801_1049451810 -6 Left 1049451801 8:142666023-142666045 CCCTCTGCTCTTCCCGGCAGCCG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1049451810 8:142666040-142666062 CAGCCGGCTTGGAGGCCATGGGG 0: 1
1: 0
2: 2
3: 19
4: 169
1049451801_1049451812 -3 Left 1049451801 8:142666023-142666045 CCCTCTGCTCTTCCCGGCAGCCG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1049451812 8:142666043-142666065 CCGGCTTGGAGGCCATGGGGAGG 0: 1
1: 0
2: 0
3: 21
4: 214
1049451801_1049451808 -8 Left 1049451801 8:142666023-142666045 CCCTCTGCTCTTCCCGGCAGCCG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1049451808 8:142666038-142666060 GGCAGCCGGCTTGGAGGCCATGG 0: 1
1: 0
2: 2
3: 22
4: 271
1049451801_1049451809 -7 Left 1049451801 8:142666023-142666045 CCCTCTGCTCTTCCCGGCAGCCG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1049451809 8:142666039-142666061 GCAGCCGGCTTGGAGGCCATGGG 0: 1
1: 0
2: 0
3: 15
4: 139
1049451801_1049451816 6 Left 1049451801 8:142666023-142666045 CCCTCTGCTCTTCCCGGCAGCCG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1049451816 8:142666052-142666074 AGGCCATGGGGAGGGGTGGCTGG 0: 1
1: 3
2: 10
3: 73
4: 778
1049451801_1049451815 2 Left 1049451801 8:142666023-142666045 CCCTCTGCTCTTCCCGGCAGCCG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1049451815 8:142666048-142666070 TTGGAGGCCATGGGGAGGGGTGG 0: 1
1: 1
2: 4
3: 95
4: 745
1049451801_1049451818 22 Left 1049451801 8:142666023-142666045 CCCTCTGCTCTTCCCGGCAGCCG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1049451818 8:142666068-142666090 TGGCTGGTCCTAGCACTTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 103
1049451801_1049451814 -1 Left 1049451801 8:142666023-142666045 CCCTCTGCTCTTCCCGGCAGCCG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1049451814 8:142666045-142666067 GGCTTGGAGGCCATGGGGAGGGG 0: 1
1: 0
2: 5
3: 50
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049451801 Original CRISPR CGGCTGCCGGGAAGAGCAGA GGG (reversed) Exonic
900490973 1:2949006-2949028 CAGGTGCCGGGGAGGGCAGACGG + Intergenic
900553479 1:3268471-3268493 GGGCGGCCGGGGAGGGCAGACGG + Intronic
900927166 1:5712945-5712967 AGGCTGCTGGGAAGACCACAGGG + Intergenic
901020890 1:6254868-6254890 CGGCTGCCTGGCAGTGCAGTGGG - Exonic
901024032 1:6269759-6269781 CGGGAGACGGGAAGAGCAGTGGG - Intronic
901898793 1:12340125-12340147 AGGCTGCTGACAAGAGCAGAGGG - Intronic
903576527 1:24342803-24342825 CGGCTGGCGTGAAGGGGAGAAGG + Intronic
904348732 1:29891177-29891199 GGGCTGTGGGGAAGGGCAGAGGG + Intergenic
904681504 1:32232642-32232664 CGGCTGCCGGAGAGTCCAGATGG + Intergenic
905507827 1:38494246-38494268 CGGCAGCCAGGATGAGCACAGGG - Intergenic
906197174 1:43936388-43936410 CCCCCGCGGGGAAGAGCAGATGG - Exonic
910277570 1:85465129-85465151 CGGCTGCCAAGAGGAGCCGACGG - Exonic
912718982 1:112003961-112003983 ATGCTGCAGGGAAGTGCAGAAGG + Intergenic
915384968 1:155482271-155482293 CGGCTACCAAGAAGAGTAGATGG + Exonic
918164080 1:181927755-181927777 TGGCTACAGGGAAAAGCAGAGGG - Intergenic
918332247 1:183471911-183471933 GGGCTGCAGCGAAGAGGAGAGGG + Intergenic
919709301 1:200710388-200710410 AGGGAGCTGGGAAGAGCAGAAGG + Intergenic
919760324 1:201094072-201094094 CGGCTGCAGGGAAGAGAGCAAGG - Intronic
919877252 1:201878617-201878639 CGGCTGTGGGTGAGAGCAGAAGG + Exonic
919978933 1:202630457-202630479 AGGCTTCCTGGAAGAGCAGCAGG + Intronic
920295403 1:204953191-204953213 CAGCTCCCAGGAGGAGCAGAGGG + Intronic
920436752 1:205951891-205951913 CAGCTGGCAGGAAGAGGAGAGGG - Intergenic
920880918 1:209879740-209879762 GGGCTGCCAGGCAGAGCAGCCGG - Intergenic
924436687 1:244048917-244048939 CGGCGGCCGGGAGGAGGAGGAGG + Intronic
1067728333 10:48790566-48790588 AGGCTGGGGGGAAGAGCAGGAGG - Intronic
1069957425 10:72060610-72060632 CGGCTGCCTCAGAGAGCAGAGGG + Exonic
1070002746 10:72393073-72393095 GGGCTGCTGGGAAGGGTAGAAGG + Intronic
1070362392 10:75703374-75703396 CTGCTGCCTGGAAGAGAAAACGG - Intronic
1070675141 10:78407042-78407064 GAGCTGTCGGGAAGATCAGAAGG - Intergenic
1070777410 10:79117941-79117963 CAGCTGCTGGGAAAAGGAGAAGG - Intronic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1073281832 10:102360198-102360220 CGGATGCAGGGAAGACCATAGGG - Exonic
1073380888 10:103077309-103077331 CGGCTCCTGGGAAGGGCACAAGG - Exonic
1075078901 10:119369761-119369783 GGGCTTCCGGGCAGAGGAGAGGG + Intronic
1075311682 10:121419628-121419650 CGGCTTCTGGCAAGAGGAGAGGG + Intergenic
1075634342 10:124020055-124020077 CAGCTGGCGGGGAGAGAAGATGG - Intronic
1076302523 10:129438839-129438861 GGGCTGCAGGGGAGAGCAGGTGG - Intergenic
1078886585 11:15506491-15506513 TGGCTGAGAGGAAGAGCAGAAGG + Intergenic
1079486078 11:20937196-20937218 AGGCTGCCAGGAAGGGCAGCGGG - Intronic
1080659676 11:34285619-34285641 CGGCTCCAGGGTAGAGCAGCAGG - Intronic
1081879729 11:46438374-46438396 CTGATGCCTGGAGGAGCAGATGG + Intronic
1083961573 11:66017543-66017565 TGGCTACAGGGAAGAGCAGGTGG - Intronic
1084014318 11:66369642-66369664 CGGCTGCTGGGAACAGAACAAGG - Intronic
1084374069 11:68764115-68764137 CCCCTGCTGGGAATAGCAGATGG + Intronic
1084425906 11:69084521-69084543 CGGCCACCAGGCAGAGCAGATGG - Intronic
1084621324 11:70271654-70271676 CAGCTCCCGGGAAGAACTGACGG - Intronic
1085199999 11:74696206-74696228 GGGCTGCCCGGAAAAGCAGGAGG + Intergenic
1085253940 11:75161735-75161757 GGGCTGCCAGGAGGAGCAGGTGG + Intronic
1085666078 11:78417151-78417173 CGGCGGCCGGGAGGGGCAGGCGG + Intronic
1086866158 11:91982500-91982522 GGGCAGCCAGGAAGAGCTGAGGG - Intergenic
1089002067 11:115060256-115060278 CAGCTGCCAGGATGGGCAGAGGG - Intergenic
1089353999 11:117837909-117837931 CGGGGGCAGGGAGGAGCAGATGG + Exonic
1089580513 11:119479014-119479036 AGGCTCCAGGGAAGAGCACAGGG - Intergenic
1089603019 11:119626692-119626714 CGGCTGGTGGGAAGAACTGAGGG + Intronic
1092170286 12:6370100-6370122 GGGCTGCCTGCCAGAGCAGATGG - Intronic
1093234478 12:16589798-16589820 CATCTGCCAGGAAGAACAGAGGG + Intronic
1096459527 12:51814548-51814570 CGGCTGCCGGGAGGCGCTGGCGG - Intergenic
1096682959 12:53269042-53269064 CGGCTGCTGGGAAAACCAGCTGG - Exonic
1097990108 12:65825060-65825082 CGGCTGCCAAAAAGAGAAGAGGG - Exonic
1100816122 12:98388990-98389012 CGGCTTCGGGGAAGAAAAGAGGG - Intergenic
1101900281 12:108786918-108786940 CTGCTGCTGGGAAGAGCTGGAGG + Exonic
1102016673 12:109652641-109652663 CTGCTGCCGAGAAGCGCAGAAGG - Intergenic
1107359354 13:39602738-39602760 CGGCTGGCAGGCAGAGCCGACGG + Intronic
1111911547 13:94318113-94318135 CGGCTTCATGGAAGAGTAGAGGG + Intronic
1113871596 13:113563262-113563284 CTCCTGCAGGGAAGAGCAGTGGG - Intergenic
1113926035 13:113942262-113942284 CTCCTGCAGGGAAGAGCAGTGGG - Intergenic
1118809011 14:69260395-69260417 CGGCGGCCGGGGCGCGCAGAGGG + Exonic
1119031060 14:71193037-71193059 CGAGTGCTGGGAGGAGCAGAAGG + Intergenic
1119225600 14:72942611-72942633 CGGCTGCCGGGAAGAGCCCCAGG - Intronic
1119729175 14:76940248-76940270 CAGCTGGCTGGAAGAGCAAATGG + Intergenic
1123696386 15:22881934-22881956 CAGCTGCCGGGGAGATGAGACGG + Exonic
1128516267 15:68343952-68343974 CGGCAGCTGGGGTGAGCAGAAGG + Intronic
1129491093 15:75926405-75926427 TGGCTGCCTGATAGAGCAGATGG - Intronic
1131989145 15:98076663-98076685 AGGCTTCCAGGAACAGCAGAGGG + Intergenic
1132983641 16:2752392-2752414 CCGCTGCGGGGAGGAGCACAGGG - Exonic
1133234922 16:4383258-4383280 AAGCTCCCGGAAAGAGCAGAGGG + Exonic
1135732727 16:24908055-24908077 CGGCTGCAGGTAGGAGCTGATGG - Exonic
1139510919 16:67428229-67428251 CGGCTGCTGGGTTGAGGAGAGGG - Intergenic
1142129920 16:88427789-88427811 AGGCTGGCGGGCAGGGCAGAGGG + Exonic
1142137236 16:88457081-88457103 GGGCTGCTGGGGAGAGCAGGTGG - Intronic
1142851788 17:2707974-2707996 GGGCTGCTGGGAAGGGAAGATGG - Intronic
1143185656 17:5008526-5008548 GGGCTGCCTGGAAGAGGTGATGG + Intronic
1144665085 17:17096916-17096938 CGGCTGCTGGGAAGACCAAGGGG + Intronic
1145197636 17:20908632-20908654 CGGGTGGCGGGAAGAGCCCAGGG + Intergenic
1146382547 17:32341811-32341833 CGGGGGCCAGGAAGAGCAGCGGG + Intronic
1146453143 17:32990700-32990722 GGGCAGCCTGGAAAAGCAGAGGG + Intronic
1148563691 17:48620678-48620700 CTACTGCAGGGAAGAACAGAGGG + Intronic
1148736607 17:49868678-49868700 CGGGCGGCGGGCAGAGCAGAGGG - Intergenic
1152269572 17:79316141-79316163 AGGCTGCGCGGAAGAGGAGAAGG + Intronic
1158192285 18:54844008-54844030 TGGCTGCAGGGAGGAGGAGAAGG + Intronic
1158976565 18:62715927-62715949 CCGCTGCCGGGCAGAGCGGGGGG + Exonic
1160200564 18:76792356-76792378 CAGCTGCCAGGAAGTCCAGAGGG + Intergenic
1160299340 18:77666212-77666234 CGGCTGCCGTCATGAGGAGATGG + Intergenic
1160514818 18:79472410-79472432 AGGCTGCCGGGCTGAGCAGAAGG - Intronic
1160571232 18:79818871-79818893 CGGCAGCCATGAAGAGCCGAAGG + Intergenic
1161031850 19:2061329-2061351 CGGCCGCCGGGAGGAGGAGGAGG - Intergenic
1163730239 19:18944875-18944897 CAGCTTTCGGGAAGAGCAGGTGG - Intergenic
1165331843 19:35144575-35144597 CGCCTGCTGGGAAGCGCGGAAGG - Intronic
1166197971 19:41219230-41219252 CGGCTGCTGGGCAGAGCCGGTGG + Exonic
1167579259 19:50332285-50332307 TGGCTGCTGTGAAAAGCAGAAGG - Intronic
1168258858 19:55181670-55181692 CAGATTCCTGGAAGAGCAGAGGG - Exonic
925169297 2:1741075-1741097 CGGCTCCAGGGAAGAGAGGAAGG + Intronic
925210638 2:2042889-2042911 TGCCTGCAGGGAAGAGCAGGGGG - Intronic
929347954 2:40909675-40909697 CGGCGGCTGGGAAGAGTAGGGGG - Intergenic
932047307 2:68362824-68362846 CAGCTGGAGGGAAGAGGAGAGGG + Intergenic
937073224 2:119081580-119081602 CTGCTGCTGGGAATAGAAGATGG - Intergenic
937157232 2:119729915-119729937 GGGCTGCCTGGAAGGGCAAAGGG - Intergenic
939387812 2:141523735-141523757 TGGCTGCCCAGAAAAGCAGAAGG + Intronic
946062594 2:216956916-216956938 GGACTACAGGGAAGAGCAGAAGG + Intergenic
947874866 2:233461338-233461360 AGGCTGCCTGGAAGGGCACACGG - Intronic
948575991 2:238950032-238950054 CCACTGCCTGGAAGAGCAGAGGG + Intergenic
948754177 2:240149658-240149680 CAGCTTCCTGGAAGAGGAGAAGG + Intergenic
1168731816 20:90520-90542 TGGTGGCAGGGAAGAGCAGAAGG - Intronic
1169275593 20:4231849-4231871 CAGCTGCCAGGAAGAACAAAGGG - Intronic
1170460597 20:16573494-16573516 CGGCGGCCGGGCGGTGCAGAGGG + Intergenic
1170890045 20:20368741-20368763 CGGCGGGCGCGAAGAGCAGCGGG - Exonic
1173295306 20:41750183-41750205 AGGCTGCTGGGAAGGGCAGCAGG + Intergenic
1179717910 21:43299466-43299488 AGGCTGGAGAGAAGAGCAGAGGG - Intergenic
1179976918 21:44873526-44873548 CGGCCACCGGGATGAGCAGCAGG + Exonic
1180057172 21:45364998-45365020 CTGTGGGCGGGAAGAGCAGATGG + Intergenic
1182268088 22:29135056-29135078 TGGCTGCCAGGGAGAGAAGAAGG - Intronic
1182572713 22:31250673-31250695 CGGATACCTGGGAGAGCAGAGGG - Intronic
1184413035 22:44336877-44336899 CGGCCTCCTGGAAAAGCAGAAGG - Intergenic
1184694058 22:46130110-46130132 AGGCTGGCGGGAGGAGCAGCAGG + Intergenic
1185399014 22:50606415-50606437 AGCCTGCCTGGAGGAGCAGAAGG + Intronic
954322349 3:49840727-49840749 CAGGAGCCAGGAAGAGCAGAGGG + Intronic
961537312 3:127577906-127577928 GGGCTGCTGGGAAAGGCAGACGG + Intronic
962277983 3:134030121-134030143 CGCCTGCCGGGAGGCGGAGAGGG + Intronic
966630766 3:182071992-182072014 CAGATGCTGGGAAAAGCAGAAGG - Intergenic
968278893 3:197460429-197460451 CAGCGGCAGGGAAGAGTAGAGGG + Intergenic
968560281 4:1276912-1276934 CTGCTGCCGGGAATGGAAGATGG + Intergenic
968844175 4:3030714-3030736 AGGCTGCTGGCAAGAGCAGGAGG + Intronic
968964284 4:3761685-3761707 TGGGTGCCGTGAAGGGCAGATGG - Intergenic
969256152 4:6003041-6003063 CTGCTGCAGGGCAGAGCAGGTGG - Intergenic
974540903 4:63233936-63233958 CTGCTGCCTGGAAGATCAGTTGG + Intergenic
979192089 4:117874276-117874298 AGGCAGCCAGGAAGAGGAGAAGG - Intergenic
982076026 4:151737967-151737989 CTGCTGCTGGGCAGTGCAGAAGG + Intronic
988861206 5:35281864-35281886 TGCCTGCCAGGAAGGGCAGAAGG + Intergenic
992112239 5:73506573-73506595 CGGCTTCCTGGCAGAGAAGATGG + Intergenic
992501394 5:77347740-77347762 AGGCTTCCTGGAAGAGAAGAGGG + Intronic
994589370 5:101754598-101754620 AGCCTGCCGGGATGAACAGATGG + Intergenic
996385822 5:122909586-122909608 GGCCTGCCGTGAAGAGTAGAGGG + Intronic
997699615 5:135887802-135887824 CTGCTGCCTGCAAGAGCACAGGG - Intronic
1001279000 5:170372470-170372492 AGGTTGCCGGGTAGAGCTGAAGG + Intronic
1003854519 6:10259383-10259405 AGGCTGCAGGGAAGGGCAGAGGG + Intergenic
1005815964 6:29553268-29553290 CGGCTGCAGGGAAGGCCAGTCGG - Intergenic
1006066030 6:31463233-31463255 CGGCTCCCGAGAACAGCAGGAGG - Intergenic
1006188098 6:32191810-32191832 CCGCCGCCTGGAGGAGCAGAGGG - Exonic
1008139008 6:47810322-47810344 CTGCTTCAGAGAAGAGCAGACGG + Intronic
1010682131 6:78809358-78809380 CAGCTGGCGTGAAGACCAGAGGG - Intergenic
1014265268 6:119269654-119269676 CGGCTGTCAGGCAGACCAGAAGG + Intronic
1015616293 6:135078795-135078817 CTGATGCCTGGAAGATCAGAGGG + Intronic
1015856062 6:137625607-137625629 CCGCTGCCAGCAAGAGAAGAGGG + Intergenic
1016923189 6:149317005-149317027 CGGCGGCCGAGAGGAGCAGGTGG - Intronic
1017096825 6:150812151-150812173 CGGGTGCCAGTGAGAGCAGAGGG - Intronic
1017874690 6:158514982-158515004 CAGCTTCCGGGAAGAGTGGACGG + Intergenic
1022552398 7:31253358-31253380 AGGCTGCAGGGAGGATCAGATGG + Intergenic
1034429915 7:151036100-151036122 CCGCTGCCGGGCAGAGGAGCTGG + Exonic
1035399754 7:158557134-158557156 CGGCTCCCGGGCAGGGCAGGCGG + Intronic
1035685819 8:1522973-1522995 TGGCTGACGTGAAGAGCAAAGGG - Intronic
1037116823 8:15237338-15237360 CCGCTGGCGGGAGGAGCAGGCGG + Intronic
1039517161 8:38143808-38143830 CAGCGGCCGGGAGGAGCAGAGGG + Exonic
1040514787 8:48125980-48126002 CGGCTGCCGTGCTGAGCAGGAGG + Intergenic
1041960254 8:63606719-63606741 CTGCTGCTGAGAAGAGCAGATGG - Intergenic
1047998526 8:130358412-130358434 CCGCCGCCGGCATGAGCAGAGGG - Intronic
1048881709 8:138877248-138877270 GGGCTGCTGGGAAGAGCCGAGGG + Intronic
1049241727 8:141540778-141540800 CGGCTGCTGGGAAGTGGAGCAGG - Intergenic
1049451801 8:142666023-142666045 CGGCTGCCGGGAAGAGCAGAGGG - Exonic
1049766650 8:144358235-144358257 CGGCTGCCGGGGAGTGCGGCGGG + Exonic
1051170474 9:14315064-14315086 CGGCTGCCGGGAAAAGGGGGAGG + Intronic
1052362191 9:27573365-27573387 CGGCTGCCGGGAAGAGGCGCGGG - Intronic
1058532639 9:105921906-105921928 AGGCTGCAAGGAAGAGCATAAGG - Intergenic
1058717952 9:107739214-107739236 TGCCAGCCGGGAAGAGAAGAAGG + Intergenic
1059449542 9:114361859-114361881 AAGCTGCCTGGAAGAGCTGAAGG - Exonic
1059799673 9:117737585-117737607 GGGCTGCCTGGAACAGCAGAGGG + Intergenic
1060931231 9:127490796-127490818 CTGTTGCAGGGGAGAGCAGAGGG - Intronic
1061135463 9:128730839-128730861 CGGCTCCCGGGCACAGCTGATGG - Exonic
1061678500 9:132231324-132231346 CTGCTGCCTCGCAGAGCAGATGG - Intronic
1062318515 9:135979438-135979460 CGGCTGCAGGGAGGAGGAGAGGG + Intergenic
1062568051 9:137171940-137171962 CTGCAGCAGGGATGAGCAGAAGG + Exonic
1185719962 X:2373561-2373583 CTGCTGCAAGGAAGAGCTGAGGG + Intronic
1189231760 X:39457800-39457822 CTGCTGCCGGGGAGGGGAGAAGG - Intergenic
1192220522 X:69194678-69194700 AGGCTGGGGGGAAGAACAGAGGG - Intergenic
1194521680 X:94926668-94926690 CAGATGCCGGGAAGGGCAGTCGG + Intergenic
1198653873 X:138892741-138892763 CGAATGCCAGGAAGAGGAGATGG + Intronic
1199745699 X:150770875-150770897 CTGCTGCTGGGAGGAGCAGTTGG - Intronic