ID: 1049451950

View in Genome Browser
Species Human (GRCh38)
Location 8:142666704-142666726
Sequence CCACCTGAGCAGCACGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049451950_1049451959 22 Left 1049451950 8:142666704-142666726 CCCTGCACGTGCTGCTCAGGTGG 0: 1
1: 0
2: 1
3: 22
4: 135
Right 1049451959 8:142666749-142666771 CAAACTGAAGCCATTCGCTAGGG No data
1049451950_1049451958 21 Left 1049451950 8:142666704-142666726 CCCTGCACGTGCTGCTCAGGTGG 0: 1
1: 0
2: 1
3: 22
4: 135
Right 1049451958 8:142666748-142666770 GCAAACTGAAGCCATTCGCTAGG No data
1049451950_1049451960 26 Left 1049451950 8:142666704-142666726 CCCTGCACGTGCTGCTCAGGTGG 0: 1
1: 0
2: 1
3: 22
4: 135
Right 1049451960 8:142666753-142666775 CTGAAGCCATTCGCTAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049451950 Original CRISPR CCACCTGAGCAGCACGTGCA GGG (reversed) Intronic
906346345 1:45017684-45017706 ACACCTGAGAAACAAGTGCAGGG - Exonic
911090398 1:94012867-94012889 CCAGCTGAACACCACGTGCCGGG - Intronic
915637846 1:157198964-157198986 CTACCTGAGCTGCATGTGGAAGG + Intergenic
916561902 1:165940772-165940794 CCACCTGAGCAGCTTTAGCAGGG + Intergenic
917014853 1:170518438-170518460 CCACCCAAGCAGCCTGTGCAGGG - Intergenic
924552926 1:245095126-245095148 CAACCGGAACAGCCCGTGCAGGG + Intronic
1069879091 10:71580666-71580688 CCACTTGAACAACACGTGCAGGG + Intronic
1070574141 10:77664675-77664697 CCACCTGAGGACCACATGCCAGG + Intergenic
1075736843 10:124669552-124669574 CCACCTGAGCACCAGGTCCTGGG + Intronic
1077268159 11:1662211-1662233 TCCACTGAGCAGCACGTGCCAGG - Intergenic
1077272725 11:1689407-1689429 TCCACTGAGCAGCACGTGCCAGG + Intergenic
1077501756 11:2912580-2912602 CCACCTGGGCAGCAGGTGGGAGG + Intronic
1077529790 11:3089842-3089864 CCACCTGTGCAGCTCCTGCTGGG + Exonic
1078660769 11:13283760-13283782 CTACCTGAGCAGCAGCTCCAGGG + Intronic
1080749117 11:35136487-35136509 CCACCTGAAGAGCAGGTGCTTGG - Intergenic
1081779011 11:45696948-45696970 CCTTCTGAGCAGCATGGGCAGGG - Intergenic
1084083473 11:66843821-66843843 CCTCCAGAGCAGCACGCACAGGG - Exonic
1084090504 11:66876515-66876537 CCTCTTGAGCAGCAGGTGCTGGG - Intronic
1085252386 11:75152393-75152415 CCAGCTGAGGAGCAGCTGCAGGG + Intronic
1087298114 11:96400728-96400750 CCACATGAGCAGAAGGTGAAAGG - Intronic
1091369077 11:135043848-135043870 CCACCTGACCAGGCCCTGCAGGG - Intergenic
1092170956 12:6373907-6373929 CCACCTCCACAGCACCTGCACGG + Intronic
1096974590 12:55692914-55692936 CCACCTGAGCAGCAGGAGCCTGG - Exonic
1097151234 12:56981310-56981332 CCAGCTGTGTAGCAAGTGCAGGG + Intergenic
1097242536 12:57585496-57585518 CCACCTTAGCACCATGTGGAAGG - Exonic
1104473945 12:129054971-129054993 CCAGCTGAGCAGCATGGGCCTGG - Intergenic
1107305744 13:39016785-39016807 CCAGCTGAGAAGCACCTGCTAGG + Intronic
1120828297 14:88974916-88974938 CTAACTGAGCAACAGGTGCATGG + Intergenic
1121026557 14:90620595-90620617 CAGCCTGTGCAGCACGTGCACGG - Intronic
1122939766 14:104976078-104976100 ACACCGGGGCAGCAGGTGCAGGG + Intronic
1124408146 15:29410385-29410407 CCACCAGAGCAGCCCCTGCAGGG - Intronic
1124632937 15:31347552-31347574 CCTCATGAGCAGCACCTCCAAGG - Intronic
1124875388 15:33587301-33587323 GCACCTGAGCAACACGTGCTAGG + Intronic
1127752664 15:62060825-62060847 CCACCTGATCCACAGGTGCAGGG - Intergenic
1129738732 15:77979664-77979686 GCTCCTGAGCAGCGCGTGCAGGG - Intergenic
1129847225 15:78773516-78773538 GCTCCTGAGCAGCGCGTGCAGGG + Intronic
1130254670 15:82320372-82320394 GCTCCTGAGCAGCGCGTGCAGGG - Intergenic
1130600303 15:85269634-85269656 GCTCCTGAGCAGCGCGTGCAGGG + Intergenic
1133315367 16:4880303-4880325 CCTCCTGAGCAGCAAGGGCCCGG - Exonic
1136470112 16:30474129-30474151 CCACCTGCTGGGCACGTGCAGGG + Intronic
1138243018 16:55444482-55444504 CCTCCTGAGCAGGAGGTGCTGGG + Intronic
1140189163 16:72800126-72800148 TCACCTGAGGAGCAAGAGCAAGG + Exonic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1141816297 16:86411749-86411771 GCAGCTGAGCAGCTCATGCAAGG - Intergenic
1141993977 16:87625504-87625526 CCCCCTGAGCAGGAGGAGCAGGG + Intronic
1142026808 16:87818783-87818805 CCCCCAGAGCAGCTCATGCACGG - Intergenic
1142483290 17:231437-231459 TCAGCTGAGCCCCACGTGCAAGG + Intronic
1143099774 17:4498766-4498788 CCCCCAGGGCAGCACGTGCGGGG + Intergenic
1144699185 17:17325689-17325711 CCTCCTGAGCATGACCTGCAGGG + Intronic
1147320460 17:39642838-39642860 CCGACAGAGCAGCAGGTGCAAGG + Intronic
1148113824 17:45162880-45162902 CCACCCAAGCACCACGAGCACGG + Intronic
1153093003 18:1369806-1369828 TCTCCTGAATAGCACGTGCATGG + Intergenic
1153246173 18:3074416-3074438 CCACCTGAGCTGGATGTGAAGGG - Intronic
1160512249 18:79459149-79459171 CCACCTGCGCAGGAATTGCAGGG + Intronic
1165049538 19:33132615-33132637 CCACCTGAGCAGGGCGTGCTGGG + Intronic
1165789985 19:38485575-38485597 CCACCTCTGCTGCAGGTGCATGG + Exonic
1166134178 19:40765435-40765457 CCACCTCAGCAGCACATCCTGGG + Intergenic
1166700105 19:44877450-44877472 CCACCTGCTCAGCCCCTGCAGGG + Intronic
1166862435 19:45818040-45818062 CCTCATGAGCAGCATGGGCAGGG + Exonic
1168190359 19:54733987-54734009 CCACCCGAGAAGCACGGGGAAGG - Intronic
926352931 2:12013815-12013837 CCACATGAGATGCACATGCATGG - Intergenic
926720201 2:15954436-15954458 CCAGCTGATCATCAAGTGCAGGG - Intergenic
926913362 2:17871706-17871728 CCACTTGAGGAGCACATTCAGGG + Intergenic
930534024 2:52624926-52624948 CCCCCTGAGCTGCACATGCATGG + Intergenic
932440019 2:71728752-71728774 TCACCTAAGCTGCACTTGCAGGG - Intergenic
936616518 2:114053474-114053496 CCACCTGAGCAGAATGTGCAAGG + Intergenic
938119123 2:128621455-128621477 CCACCTCAACAGCTCATGCATGG + Intergenic
941601359 2:167547088-167547110 CCACCACAGCAGCACGTCCTCGG + Intergenic
945831193 2:214788225-214788247 GAACCTGACCAGCACCTGCAAGG + Intronic
945976361 2:216274136-216274158 CCACCTGAGCATCATTTCCAGGG - Intronic
947377390 2:229510446-229510468 CCATCTCAGCAGCACAGGCAAGG + Intronic
947716936 2:232345565-232345587 CCCCCTCAGCAGCACGAGCAGGG - Intergenic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1170962428 20:21037343-21037365 CCACCTCAGCGCCACCTGCAAGG - Intergenic
1172969889 20:38865627-38865649 CCACCTGTGCAGGACGTGAGTGG - Intronic
1174541834 20:51295999-51296021 CCACTTCAGCAGCACATGGAGGG - Intergenic
1175938695 20:62527210-62527232 CCCCCTGCCCAGCATGTGCACGG + Intergenic
1176046946 20:63097643-63097665 CCTCCTAAGCAGGACGTGGAGGG - Intergenic
1176052775 20:63129286-63129308 CCTCCTGAGGAGCAGGTGGACGG - Intergenic
1179540178 21:42078827-42078849 GCACCTGAGCAGCATGGCCAAGG - Intronic
1179961556 21:44769976-44769998 CCAGCTGAGCAGCACAGGCCAGG - Exonic
1181489697 22:23253911-23253933 CCACCTCAGCAGCAAGGGCAGGG + Exonic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
950607642 3:14096874-14096896 CAGCCTGAGCAGCAGGTGGATGG + Intergenic
952451947 3:33440662-33440684 CCAACTGAGCAATACCTGCAAGG + Intronic
953925074 3:46978628-46978650 CCACTTGGGCAGCAGGGGCAGGG - Intronic
954662196 3:52232107-52232129 CCCCCAGAGCAGCTCGTGCTGGG - Exonic
954782810 3:53073362-53073384 CCACCTGTGCCGCAAGTGGAGGG + Intronic
955579951 3:60408215-60408237 GAAACTGGGCAGCACGTGCAGGG - Intronic
956748241 3:72326600-72326622 CCAGCTGAGCAGCACCTGGCTGG + Intergenic
972148886 4:36064563-36064585 CCACCTGAGCTGCAGGACCAGGG - Intronic
972539165 4:40024196-40024218 CCACCTCAGCAGCTGGTACAGGG - Intergenic
972801792 4:42483509-42483531 AGAGCTGAGCCGCACGTGCACGG + Intronic
984550467 4:181153248-181153270 CCTCCTTAGCAGCACGGGCCGGG + Intergenic
986084318 5:4428472-4428494 CCATCTCAGCAGCAAATGCATGG + Intergenic
986423417 5:7606983-7607005 CCACCTGCCCTGCACATGCAGGG + Intronic
989096364 5:37785509-37785531 TCACCAGAGCAGCACGTGGCAGG - Intergenic
995607726 5:113875611-113875633 CCACATGAGCAGCATGAGAAGGG + Intergenic
999390800 5:151188050-151188072 TCACATGAGAAGGACGTGCAAGG + Intronic
1002595232 5:180317868-180317890 CCTCCAGAGCATCAGGTGCAGGG - Intronic
1003096817 6:3148652-3148674 CCACCTGAGCAGCAGCTGGGAGG - Intronic
1003312650 6:4983138-4983160 TCACCTGAGCACCACTGGCAGGG - Intergenic
1003512379 6:6792234-6792256 CCATCTGCGGAGCACGTGCTGGG + Intergenic
1005461738 6:26075552-26075574 TCACCAGAGCAGCACGTGGCAGG + Intergenic
1005920396 6:30396410-30396432 CCTTCTGATCAGCACGGGCAGGG - Intergenic
1006255638 6:32830086-32830108 CCACCTGTGCAGCAGGGACAGGG + Exonic
1006937481 6:37728474-37728496 CAACCCCAGCAGCACTTGCAAGG - Intergenic
1007105265 6:39279455-39279477 CCTCCTGAGCAGCCCATGCCAGG + Intergenic
1010889705 6:81291468-81291490 CCAACTGAGCTGCAGCTGCAGGG + Intergenic
1011517775 6:88170707-88170729 CCAGCTGAGCAGCACAGGGAAGG + Intergenic
1014815111 6:125926875-125926897 CATCCTGATCAGCACTTGCAGGG - Intronic
1019121883 6:169810638-169810660 CCAGCTGATCTGCACGTGCAAGG - Intergenic
1019346593 7:533801-533823 CCCCCTGAGCCGCAGGTGCCCGG + Intergenic
1019664934 7:2247153-2247175 GCTCCTGAGCAGCACGGGCCTGG - Intronic
1020120723 7:5501767-5501789 CCAGCTGAGCAGCGAGTGCAAGG - Exonic
1022087820 7:27086280-27086302 CCATCTGAGCAGCTTGGGCAGGG + Intergenic
1022219836 7:28302660-28302682 GCTCCTGAGCAGGACGTTCATGG - Intronic
1023658267 7:42448092-42448114 CCACCTGAGTAGGAGGGGCAGGG - Intergenic
1026159132 7:67853254-67853276 CCATCTAAGCAGCATGTGCTGGG - Intergenic
1026215926 7:68348894-68348916 CCACTTGAGCGTCATGTGCACGG + Intergenic
1026900089 7:74032267-74032289 CCAGCTGAGCAGCACAGTCAGGG + Intronic
1027998962 7:85466774-85466796 CCAGCTGTGCAGGAGGTGCAAGG + Intergenic
1031385786 7:121149210-121149232 TTTCCTGAGCAGCAGGTGCACGG + Intronic
1032273585 7:130433913-130433935 CCACGTGGGCAGCACGGACATGG + Intronic
1032430524 7:131857495-131857517 ACACCTGAGCACCACCTGCAGGG - Intergenic
1033132162 7:138753938-138753960 CCAGCTGAGCAGCTTCTGCAGGG - Intronic
1040576526 8:48656586-48656608 TCACCTGAGCAGAACGTGGAAGG - Intergenic
1041810525 8:61903337-61903359 CCACCTGAGCAGGGCGGGAAAGG - Intergenic
1049163216 8:141111008-141111030 CCACCTGAGAAGCAGGTTCAGGG - Intergenic
1049451950 8:142666704-142666726 CCACCTGAGCAGCACGTGCAGGG - Intronic
1049736912 8:144213061-144213083 GCTGCGGAGCAGCACGTGCAGGG - Intronic
1050567489 9:6901316-6901338 TCACCTCAGCAGAACCTGCAGGG - Intronic
1051663480 9:19446487-19446509 ACACCTGTGCACCACTTGCAGGG - Intronic
1053413179 9:37928854-37928876 CCACCTGAGCAGCACATGGTGGG + Intronic
1055084114 9:72296530-72296552 GCAGCAGAGCAGCACATGCATGG - Intergenic
1059406142 9:114099100-114099122 CCACCTGAGCACCACCTGGATGG + Intronic
1059795645 9:117693654-117693676 CCAACTGAGGAGCACATGCCAGG - Intergenic
1061227767 9:129290724-129290746 GCACCTGAGTAGCAGGTGCATGG + Intergenic
1061536109 9:131251393-131251415 CCACATGAGCAGCTCGGCCAGGG + Intergenic
1061950218 9:133931894-133931916 CCACCTAAGCAACTGGTGCACGG - Intronic
1187509948 X:19908755-19908777 CGACCTGAAAAGCAAGTGCACGG + Intergenic
1189320909 X:40086621-40086643 CCACCTCTGCAGCTCGTCCATGG + Intronic
1190344624 X:49326143-49326165 ACACCTGAAAAGCACATGCAAGG - Intronic
1190345717 X:49335700-49335722 ACACCTGAAAAGCACATGCAAGG - Intronic
1190346820 X:49345250-49345272 ACACCTGAAAAGCACATGCAAGG - Intronic
1190348070 X:49536277-49536299 ACACCTGAAAAGCACATGCAAGG - Intronic
1190349171 X:49545833-49545855 ACACCTGAAAAGCACATGCAAGG - Intronic
1190350275 X:49555389-49555411 ACACCTGAAAAGCACATGCAAGG - Intronic
1190351377 X:49564948-49564970 ACACCTGAAAAGCACATGCAAGG - Intronic
1190352477 X:49574501-49574523 ACACCTGAAAAGCACATGCAAGG - Intronic
1190353578 X:49584049-49584071 ACACCTGAAAAGCACATGCAAGG - Intronic
1190354680 X:49593571-49593593 ACACCTGAAAAGCACATGCAAGG - Intronic
1190355785 X:49603121-49603143 ACACCTGAAAAGCACATGCAAGG - Intronic
1194935944 X:99949174-99949196 ATACCTGTGCAGAACGTGCAGGG + Intergenic
1197995241 X:132365918-132365940 CAACCTGAGAAGCACCTGCAAGG - Intergenic
1198094629 X:133367065-133367087 CCACCTGAGCAGCAGCTTAAGGG - Intronic
1198594170 X:138218111-138218133 CCACAGGAGCAGCACCTCCAAGG - Intergenic
1200084000 X:153593951-153593973 CCTTCTGAGCTGCCCGTGCATGG + Intronic
1201308003 Y:12567664-12567686 TCACCAGAGCAGCACGTGGCAGG + Intergenic