ID: 1049452188

View in Genome Browser
Species Human (GRCh38)
Location 8:142668100-142668122
Sequence CCTCAAGTACTGCTGGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049452188 Original CRISPR CCTCAAGTACTGCTGGCCTG CGG (reversed) Intronic
900873218 1:5321220-5321242 CCTCAAGTACTGGTGGCCCTTGG - Intergenic
904013933 1:27406134-27406156 CTCCAACTACTGCTGGGCTGCGG + Exonic
904310784 1:29628288-29628310 CCTCCAACACTGCTGGCCAGTGG - Intergenic
905408190 1:37751637-37751659 CCTCATGATCTGCTGGCCTCAGG - Intronic
906748640 1:48239417-48239439 CCTTCAGCACTGCTGGCCTCCGG - Exonic
909098109 1:71315364-71315386 CCTCTAGTGCTGCTGGACTAGGG - Intergenic
915016397 1:152737908-152737930 CCTCCAGTACTGCTTGTATGAGG - Intronic
915361447 1:155288400-155288422 GCTCAGGCACTGGTGGCCTGGGG - Exonic
919499451 1:198317513-198317535 CCTTAAGTTCTCCTGGCATGAGG - Intronic
920838860 1:209537043-209537065 CCACAAAAACTGCTGGGCTGAGG - Intergenic
922359736 1:224810503-224810525 CCACATGCACTCCTGGCCTGGGG - Intergenic
1063293782 10:4780669-4780691 CCTCACCTAATACTGGCCTGAGG - Intergenic
1067770539 10:49120366-49120388 CCTCAAGGACTACTGAGCTGGGG - Intergenic
1067800029 10:49352531-49352553 CCTCTAGGGCTGTTGGCCTGAGG + Intergenic
1068987489 10:63120711-63120733 CCCCAAGGACTTCTGGGCTGGGG + Intergenic
1069491085 10:68861118-68861140 CCTCTAGCACTGCTGGGTTGGGG - Intronic
1069630417 10:69894132-69894154 CCAGAAGAACTTCTGGCCTGGGG - Intronic
1072618954 10:97067424-97067446 ACTCAGGCAGTGCTGGCCTGGGG - Intronic
1073424614 10:103448947-103448969 CCTCAAGTGTTGCTGACCTAAGG - Intronic
1075297531 10:121291484-121291506 CCTCAAGTTCTACTGGACTCGGG + Intergenic
1077051126 11:567539-567561 CCTCAACTCCTGCAGGCCTGGGG + Intergenic
1077658472 11:4045146-4045168 CTTGATGTACTGCTGGCCTCAGG + Intronic
1078089073 11:8252684-8252706 CCTCACGGGCTGCTGGACTGAGG - Intronic
1078199336 11:9166015-9166037 CCACCAGTACTGCTGACCTTTGG - Intronic
1078655558 11:13235573-13235595 TATCAAGTGATGCTGGCCTGGGG - Intergenic
1081674958 11:44963326-44963348 CCTGAAGAACAGATGGCCTGAGG + Intergenic
1083961264 11:66016214-66016236 GCTCAAGTCCTTCTGGCCTCAGG - Intergenic
1085323810 11:75591587-75591609 GCCCAAGGACAGCTGGCCTGTGG - Intronic
1087959176 11:104326545-104326567 CCTCAAGTACTAATGCCCTGGGG + Intergenic
1089534007 11:119149665-119149687 CCCCAGGGGCTGCTGGCCTGCGG + Intronic
1090795058 11:130127991-130128013 CCTCAAGTATTGCTAACCTATGG + Intronic
1094182563 12:27607618-27607640 TCTCAAGTTATGCTGGTCTGGGG + Intronic
1094374446 12:29775369-29775391 TCAGAAGTACTGGTGGCCTGAGG - Intronic
1095832577 12:46603597-46603619 CCTCAAGCATTGCTGACCTTGGG + Intergenic
1096715600 12:53489385-53489407 GCTCAACTACAGCTCGCCTGAGG - Intronic
1097708932 12:62897364-62897386 CCACAGATACTGCTTGCCTGAGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1100473852 12:94917560-94917582 CCTCAGGTTCCCCTGGCCTGTGG - Intronic
1101396136 12:104349738-104349760 CTTCAAGAACTGCTGGCAGGAGG - Exonic
1103304864 12:119956014-119956036 CCTCAAGGAGTTCTGGGCTGGGG - Intergenic
1103621093 12:122187759-122187781 CCCCAAGTGCTGCAGGCCGGCGG - Exonic
1105003588 12:132707097-132707119 GCTCAAGTCCTGCTTGCCTTGGG + Intergenic
1105641661 13:22271095-22271117 CCTCAAAGACTGTTGGACTGAGG - Intergenic
1110520795 13:76473638-76473660 CCTCCAGTTCTGCTGGGTTGTGG - Intergenic
1113512551 13:110867630-110867652 CCTCCAGTCCTCCCGGCCTGTGG - Intergenic
1117580712 14:57148933-57148955 CCCCAAGAGCTCCTGGCCTGGGG - Intergenic
1117789496 14:59324515-59324537 CCTCATCAAGTGCTGGCCTGTGG + Intronic
1120043529 14:79780136-79780158 CCACAAGTACCTCTGGCCTTTGG + Intronic
1122635741 14:103128844-103128866 CCTCGGGGTCTGCTGGCCTGGGG + Intronic
1124693603 15:31845620-31845642 CCTCAGGAAGGGCTGGCCTGGGG + Intronic
1125283443 15:38068244-38068266 CTCCAAGTACTGGTGGACTGGGG + Intergenic
1125825981 15:42676873-42676895 CATCAAATGCTGCTGGCCTGAGG - Intronic
1126098673 15:45106770-45106792 CCTCATTTCCTGCTGGCCTGAGG - Intronic
1126489114 15:49216579-49216601 CCACAAGTACTGCAGTCCTCGGG - Intronic
1130222957 15:82036654-82036676 CCTCAAGTACTCGTGGACAGAGG + Intergenic
1130627934 15:85535142-85535164 CCTCAGGAACTGCTCACCTGTGG - Intronic
1134039108 16:11054188-11054210 CCTCATGCCCTGCTGGGCTGGGG + Intronic
1134776717 16:16859591-16859613 CCTCCACTGCTGCTGGCCTCGGG + Intergenic
1137371012 16:47905820-47905842 CCTAAAGGAATGTTGGCCTGAGG + Intergenic
1138116098 16:54361906-54361928 GATGAAGTACTGCTGGCATGTGG - Intergenic
1142850516 17:2702437-2702459 CCTCATGTAGGGGTGGCCTGAGG + Intronic
1143045221 17:4072946-4072968 CCTGAAATACTGCTGCTCTGTGG + Intronic
1143186319 17:5012562-5012584 GCTCAAGTCCAGCGGGCCTGGGG + Intronic
1143993189 17:10984490-10984512 CCTCAGAAACTGCTGCCCTGAGG + Intergenic
1144683480 17:17210871-17210893 CTTCAAGAACTGCATGCCTGTGG + Intronic
1145219950 17:21080099-21080121 CCTCTAGCACTGCTGGGTTGAGG - Intergenic
1145800998 17:27684688-27684710 CCTCTAGTGCTGCTGGGTTGGGG + Intergenic
1146454442 17:32998009-32998031 CCTCCATTTCTGGTGGCCTGTGG + Intergenic
1146837443 17:36123552-36123574 CCTGAAGCCCTGCTAGCCTGTGG - Intergenic
1148464885 17:47858989-47859011 CCTCTAGAACTCCTGGCCTCAGG + Intergenic
1149248948 17:54745804-54745826 CCTCTAGCACTGCTGGGCTAGGG - Intergenic
1152116074 17:78388151-78388173 CTTCAAGAACTCTTGGCCTGAGG + Intronic
1155438156 18:25834225-25834247 CCCCAAGCATGGCTGGCCTGGGG - Intergenic
1157311446 18:46556412-46556434 CCTCAAGAGTTGCTGGTCTGGGG + Intronic
1157560234 18:48640349-48640371 CCTCAACCACTTCTGGCCTAGGG + Intronic
1162253030 19:9462550-9462572 CCTCTAGTGCTGCTGGATTGTGG + Intergenic
1165104126 19:33458934-33458956 CCTCGAGTACAGATGGGCTGGGG - Intronic
926122850 2:10254241-10254263 TCCCAGGTTCTGCTGGCCTGGGG + Intergenic
928890895 2:36201735-36201757 CCTCAAGTGCTGGTATCCTGGGG + Intergenic
929428892 2:41870353-41870375 CCTGAACCACTGCTGGCCGGGGG - Intergenic
932122322 2:69113188-69113210 CCCCTAGTCCTGCTGTCCTGCGG + Intronic
933871277 2:86567852-86567874 CCTCAGGATCTGCTGGCCTCGGG - Intronic
935185356 2:100726811-100726833 TCTTAAAAACTGCTGGCCTGGGG + Intergenic
937499813 2:122466225-122466247 CCTCACGTGCTGCTGGACGGAGG + Intergenic
938201109 2:129373836-129373858 CCTCCAGTGCTCCTGGCCTGAGG + Intergenic
938735094 2:134178523-134178545 TTTCTAGTAGTGCTGGCCTGTGG - Intronic
939955124 2:148521429-148521451 CCAGAAGGACTGGTGGCCTGAGG + Intergenic
940167458 2:150790934-150790956 CCTGAACTACTGCAGGCTTGTGG - Intergenic
941308158 2:163896127-163896149 TCTCAAGTACTGAAGGCCTGTGG - Intergenic
941868769 2:170361856-170361878 CCTCAAGCCCTGCTTGTCTGGGG - Intronic
942303173 2:174582119-174582141 CCTCATGTCCTGTTGGCATGAGG + Intronic
943466086 2:188230857-188230879 CCTCTAGTACTGCTGGGTTAGGG - Intergenic
945174042 2:207023676-207023698 ACTCAAGTCCTGCTTACCTGGGG + Intergenic
945325720 2:208480208-208480230 CATCAAGTCCTGCAGTCCTGGGG - Intronic
946405145 2:219488492-219488514 CCTCAAGGACTTCTTGTCTGGGG - Exonic
948161877 2:235831330-235831352 CCTAAAGTACAGATGGACTGAGG - Intronic
1169342345 20:4805963-4805985 CCAGAAGTACAGCAGGCCTGGGG + Intronic
1169799499 20:9500383-9500405 CTTTAGGAACTGCTGGCCTGGGG - Intergenic
1170683268 20:18545697-18545719 TCTCAGGCAATGCTGGCCTGAGG - Intronic
1171521429 20:25777585-25777607 CCTTAAGAACTACTAGCCTGAGG + Intronic
1171555385 20:26078281-26078303 CCTTAAGAACTACTAGCCTGAGG - Intergenic
1173241341 20:41300525-41300547 CCTCAAGCACTACTAGACTGGGG + Intronic
1176655255 21:9582701-9582723 CCTTAAGAACTACTAGCCTGAGG + Intergenic
1178918429 21:36722689-36722711 ACTCAAGTCCTGCTACCCTGAGG + Intronic
1179016684 21:37600065-37600087 CTTCCAGTTCTGGTGGCCTGTGG + Intergenic
1180072065 21:45441532-45441554 CCTCCAGTCCTGCTGCCCGGTGG + Intronic
1180187925 21:46149628-46149650 CCTCAGGTCCTGCTGGGGTGTGG - Intronic
1182446728 22:30393991-30394013 CCACAAGGAATGCTGGGCTGGGG + Intronic
1182954257 22:34406575-34406597 CCTCAGGAAGTGCTGGCCTGGGG - Intergenic
1183197607 22:36364265-36364287 CCTCTAGTCCTGCAGGGCTGAGG + Intronic
1183460527 22:37947271-37947293 CCTCACTTACTGGTGGCTTGAGG + Exonic
1184059410 22:42073134-42073156 CCTCAAGCACAACAGGCCTGAGG + Intergenic
1185008361 22:48299203-48299225 CCTTCACTGCTGCTGGCCTGGGG - Intergenic
1185126560 22:49014428-49014450 ACTCAATGACTGCTGGCCAGGGG - Intergenic
1185397874 22:50601615-50601637 CCCCAAGCTCTGCTCGCCTGTGG - Intronic
950115081 3:10445567-10445589 CATCCAGTACTGCTGGGCTGTGG + Intronic
951118351 3:18892229-18892251 GCACAGGTACTGTTGGCCTGAGG - Intergenic
952755533 3:36862853-36862875 CTTCAAGTACAGCTGGCTTCAGG - Intronic
954442546 3:50529808-50529830 TCCCAAGTACCGCTGGCCTTTGG + Intergenic
955333780 3:58068686-58068708 CACCAGGTCCTGCTGGCCTGGGG + Intronic
958923835 3:100136382-100136404 CTTCAAGTCCTGCAGTCCTGGGG - Intronic
961822315 3:129581346-129581368 CCTGAAGAACTGCAGACCTGGGG + Intronic
965490934 3:169335000-169335022 GCTCCAGTTCTGCTGGCCTGTGG + Intronic
966506156 3:180703946-180703968 CCTCTAGTGCTGCTGGCCTAGGG + Intronic
968814147 4:2812978-2813000 CCTCAGGGACTGCCGGGCTGGGG + Intronic
969442778 4:7227191-7227213 CCTGAAGCACTGCTGGCCTCTGG - Intronic
971201044 4:24509378-24509400 CTTCAGGGCCTGCTGGCCTGGGG + Intergenic
971382927 4:26116395-26116417 TCTCAAGGAGTACTGGCCTGAGG + Intergenic
971447283 4:26764589-26764611 TCTCAAGTACTGCTGAACTCAGG + Intergenic
973754397 4:54059871-54059893 CCTCAAGAACTTATAGCCTGTGG + Intronic
973927061 4:55749213-55749235 CTACAAGTACTGCAGCCCTGGGG - Intergenic
975748067 4:77494045-77494067 CCTTAGGCACTGTTGGCCTGAGG + Intergenic
975808309 4:78136871-78136893 CCAAAAGTACTTCTGGCATGAGG - Intronic
976315608 4:83655719-83655741 ACTGAAGTACTGCTGACTTGGGG + Intergenic
976541859 4:86286726-86286748 CCTCAAGTACTTCAGGAATGAGG + Intronic
978506950 4:109468442-109468464 CCTCAATTTCTGCTGGACTGTGG + Intronic
984060396 4:174982859-174982881 CCTCTAGCGCTGCTGGGCTGGGG - Intergenic
988706309 5:33729227-33729249 CCTGAAGCACTTCTGGCTTGGGG - Intronic
988849038 5:35160432-35160454 CCTTAATTACTCCTGGGCTGAGG + Intronic
989265729 5:39471365-39471387 CCTCAGGTATTGCTAGGCTGTGG + Intergenic
991590947 5:68250817-68250839 CCTCAAGTAGTGCTGGTTTTAGG - Intronic
992645265 5:78805842-78805864 CCTGAAGTGCTCCTTGCCTGGGG - Intronic
993888160 5:93441282-93441304 CCTGAGGTACTTCTGGCCTCTGG + Intergenic
997852385 5:137344467-137344489 GCTTAAGAACTGCTGCCCTGAGG - Intronic
999364465 5:151012953-151012975 CCTCAAGGACTCCCTGCCTGGGG + Intergenic
999737278 5:154522078-154522100 CTTCCAGTGCTGCTGGCCTATGG + Intergenic
1000637712 5:163662777-163662799 CCTCAAGTAGTTCTGGCAGGAGG + Intergenic
1001687009 5:173600977-173600999 CCTCAAGTTGGGCTTGCCTGAGG - Intergenic
1003119372 6:3307259-3307281 CCCCAAGTTCTGCTGGAATGTGG - Intronic
1006447014 6:34085273-34085295 CCTGCAGTGCTGCTGCCCTGGGG - Intronic
1007077078 6:39074823-39074845 CCACGAGGACTGGTGGCCTGAGG - Intronic
1007985422 6:46203045-46203067 CCTCAAAGGCTGCTGGACTGAGG - Intergenic
1008160886 6:48074033-48074055 TCTCAAGGAATGCTGGCTTGTGG + Intergenic
1009399566 6:63238167-63238189 CCTGATGTTCTGCTGGCATGAGG - Intergenic
1011237791 6:85236702-85236724 CCTCAAATCTTGCTGTCCTGTGG - Intergenic
1014432836 6:121390084-121390106 ACTCAACTTCTGCTGGCCTTGGG - Intergenic
1017603740 6:156111136-156111158 CATCAAGGACTGCTTGGCTGCGG - Intergenic
1018380571 6:163254775-163254797 CTTCAAATCCTGCTGGCCTATGG - Intronic
1018728449 6:166631298-166631320 GGTCAAGTACAACTGGCCTGTGG - Intronic
1018929309 6:168229715-168229737 CCTCAAGTAACACTGGCCTCGGG + Intergenic
1020262722 7:6539701-6539723 CCTCAGGTACTGCGGGCAGGGGG - Exonic
1020583137 7:10031109-10031131 CCTTAAGCTCTGCTGGCCAGAGG - Intergenic
1026436512 7:70403564-70403586 CCTCAAGGACTCCTGACCTCTGG + Intronic
1027651495 7:80874052-80874074 CCCCAAGTGTTCCTGGCCTGAGG + Intronic
1029859096 7:103549987-103550009 CCTCAAGAACTGATAGCCAGAGG - Intronic
1031974257 7:128084053-128084075 CTTCCAGTGCTGCTGGGCTGGGG - Intronic
1032018284 7:128393204-128393226 CTTCAGGGAATGCTGGCCTGGGG - Intronic
1034942938 7:155243701-155243723 CCTCTAGTACTGCTGGGTTAGGG - Intergenic
1043785481 8:84393287-84393309 CTTCAAGTGCTGTTGGACTGAGG + Intronic
1045429209 8:102097576-102097598 CATCCAGAACTGCTGGCCTTGGG - Intronic
1049452188 8:142668100-142668122 CCTCAAGTACTGCTGGCCTGCGG - Intronic
1049493661 8:142918028-142918050 CTGCAAGTCCTGCTGGTCTGAGG + Intergenic
1049544829 8:143225755-143225777 CCCCAAGGCCTGCTGGGCTGCGG - Intergenic
1049569352 8:143361186-143361208 CCTCAACCTCTGCAGGCCTGCGG - Intergenic
1049800719 8:144516343-144516365 CCTCCACTGCTGCTGGGCTGGGG + Exonic
1051114796 9:13682407-13682429 TCTCAAGTAATGAGGGCCTGGGG + Intergenic
1056929531 9:90862459-90862481 CCAGAGCTACTGCTGGCCTGGGG - Intronic
1060967071 9:127717339-127717361 CTCCAAGCACTGCTGGCCTCTGG - Exonic
1061195373 9:129104255-129104277 CCTCCAGTACCGCCAGCCTGTGG - Exonic
1062046457 9:134426735-134426757 CCTCACATCCTGCAGGCCTGGGG - Intronic
1203632975 Un_KI270750v1:86173-86195 CCTTAAGAACTACTAGCCTGAGG + Intergenic
1186390762 X:9156482-9156504 GCTCAAGTTGGGCTGGCCTGAGG - Intronic
1187006240 X:15235298-15235320 CATGAAGGACTGCTGGCCTGGGG + Intronic
1190360560 X:49644932-49644954 CCTCCAGTCCTGCTGACCGGAGG - Intergenic
1190430794 X:50376203-50376225 TCTGAAGGACTTCTGGCCTGGGG + Intronic
1193979091 X:88158957-88158979 CATTAAGTTCTGCTGGCCTAGGG + Intergenic
1196918323 X:120561419-120561441 ACTCAAGTCCTGCGGACCTGGGG - Intronic
1197530383 X:127616807-127616829 CTTCAAGTACTGCTCCCCTTGGG - Intergenic