ID: 1049456426

View in Genome Browser
Species Human (GRCh38)
Location 8:142693339-142693361
Sequence CCCAGAGGTGTGGGATCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049456426_1049456434 6 Left 1049456426 8:142693339-142693361 CCAAAGGATCCCACACCTCTGGG No data
Right 1049456434 8:142693368-142693390 CCACTAACCCCTAGTCCCTAGGG No data
1049456426_1049456439 17 Left 1049456426 8:142693339-142693361 CCAAAGGATCCCACACCTCTGGG No data
Right 1049456439 8:142693379-142693401 TAGTCCCTAGGGGAACATAAAGG No data
1049456426_1049456432 5 Left 1049456426 8:142693339-142693361 CCAAAGGATCCCACACCTCTGGG No data
Right 1049456432 8:142693367-142693389 TCCACTAACCCCTAGTCCCTAGG No data
1049456426_1049456435 7 Left 1049456426 8:142693339-142693361 CCAAAGGATCCCACACCTCTGGG No data
Right 1049456435 8:142693369-142693391 CACTAACCCCTAGTCCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049456426 Original CRISPR CCCAGAGGTGTGGGATCCTT TGG (reversed) Intergenic
No off target data available for this crispr