ID: 1049457232

View in Genome Browser
Species Human (GRCh38)
Location 8:142699930-142699952
Sequence TTACTAGTAAGGCCCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049457232_1049457237 1 Left 1049457232 8:142699930-142699952 CCAGGCAGGGGCCTTACTAGTAA 0: 1
1: 0
2: 1
3: 6
4: 51
Right 1049457237 8:142699954-142699976 CACGTTTTGGGAAGTCCTCAGGG 0: 1
1: 0
2: 1
3: 9
4: 141
1049457232_1049457238 9 Left 1049457232 8:142699930-142699952 CCAGGCAGGGGCCTTACTAGTAA 0: 1
1: 0
2: 1
3: 6
4: 51
Right 1049457238 8:142699962-142699984 GGGAAGTCCTCAGGGCACGCAGG 0: 1
1: 0
2: 0
3: 10
4: 159
1049457232_1049457236 0 Left 1049457232 8:142699930-142699952 CCAGGCAGGGGCCTTACTAGTAA 0: 1
1: 0
2: 1
3: 6
4: 51
Right 1049457236 8:142699953-142699975 GCACGTTTTGGGAAGTCCTCAGG 0: 1
1: 0
2: 1
3: 16
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049457232 Original CRISPR TTACTAGTAAGGCCCCTGCC TGG (reversed) Intergenic
901927338 1:12574689-12574711 TTCTTGGTAAGACCCCTGCCAGG + Intronic
903373825 1:22853537-22853559 TTTCTAGGATGTCCCCTGCCAGG - Intronic
904686915 1:32266954-32266976 AGACCAGTAAGGTCCCTGCCAGG - Intronic
905561332 1:38929575-38929597 GTACCAGGCAGGCCCCTGCCGGG + Intronic
912856911 1:113177755-113177777 CTCCTCCTAAGGCCCCTGCCTGG + Intergenic
915438709 1:155929809-155929831 TTGCTAGTTAGGCCTTTGCCAGG + Exonic
917899308 1:179526213-179526235 TTACTACAAATGCCCCTGCGGGG - Intronic
922789389 1:228302723-228302745 TAACTTGTGAGCCCCCTGCCTGG + Intronic
923728954 1:236532234-236532256 TTACGAGGCAGGCCCCTGGCTGG - Intronic
924114861 1:240735258-240735280 TTATTAGTCAGGCCCCTCCAGGG - Intergenic
1078467619 11:11561836-11561858 TTACTATTAATTCCCCTGCCCGG - Intronic
1084201546 11:67561994-67562016 TTTCTAATAAGGCCCCTCTCAGG + Intergenic
1089737689 11:120561412-120561434 TCACCAGCAAGGCCTCTGCCTGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1102859395 12:116322174-116322196 TCAGTAGTAAGGACCCTGCCCGG - Intergenic
1108292647 13:48976397-48976419 CTACTAGTCGGGCACCTGCCGGG + Intronic
1117457245 14:55910862-55910884 TTCCTGGCAAGGCTCCTGCCAGG + Intergenic
1117931271 14:60843083-60843105 TTACTAGTAAAGCAGCTGGCTGG + Intronic
1122687803 14:103518320-103518342 TTGCTAGGAAGGCCCGGGCCAGG - Intergenic
1130536839 15:84791793-84791815 TTCCTGGTCAGGCCCTTGCCAGG - Intronic
1133175508 16:4011173-4011195 GTTCTAGTAACCCCCCTGCCTGG - Intronic
1136552952 16:30991211-30991233 TGCCTGGTATGGCCCCTGCCTGG + Exonic
1140836219 16:78796693-78796715 GTATTAGAAAGGGCCCTGCCTGG + Intronic
1142425788 16:90001599-90001621 TTATTAGGAAGGCCCCTTCTGGG + Intergenic
1144155842 17:12500989-12501011 TTTCTTGTAATGCCCCTGCCTGG - Intergenic
1145242963 17:21250343-21250365 TGTCTAGGAAGGCCCCTCCCTGG - Intronic
1145752316 17:27364005-27364027 TTAAAAGAAAGGCCTCTGCCAGG - Intergenic
1151473259 17:74331006-74331028 TTACTAGAAGGGTCCCAGCCTGG - Intronic
1152795185 17:82303050-82303072 GTCCTAATAAGACCCCTGCCTGG - Intergenic
1157236531 18:45969818-45969840 TTAGTAGTTAGCCCTCTGCCAGG - Intergenic
1158972243 18:62679423-62679445 TTACCAGTAAGGGTCCTGGCAGG + Intergenic
1162035544 19:7936589-7936611 TTATTTGTAAGGGCCCTGCGAGG - Intronic
928201338 2:29249508-29249530 TTTCTACTAAAGCCCATGCCTGG - Intronic
929572857 2:43033630-43033652 TTACCAGCCCGGCCCCTGCCAGG + Intergenic
930004760 2:46887872-46887894 TAACTGGTAAGAACCCTGCCTGG + Intergenic
933725925 2:85427270-85427292 TTTCTAGTAAGTCCACTTCCAGG + Intronic
942554042 2:177152923-177152945 TTAAGAGTAAGGCCTCGGCCAGG + Intergenic
944635106 2:201668584-201668606 TTTCTGGTAAGGCCTCTTCCTGG - Intronic
1176149299 20:63581239-63581261 GGACTAGGAAGGTCCCTGCCAGG - Intergenic
1176511583 21:7752420-7752442 TTAGTAATAGGGCCCCGGCCAGG + Intronic
1178645697 21:34382948-34382970 TTAGTAATAGGGCCCCGGCCAGG + Intronic
959632135 3:108518636-108518658 CTACTAGTAGTGCCCCAGCCAGG - Intronic
969297475 4:6278396-6278418 TTGCTAGAGAGGCCGCTGCCAGG + Intronic
984312054 4:178074402-178074424 TTTCTAGCAAGGCCTCTTCCTGG + Intergenic
997046368 5:130323726-130323748 TTACTTCTAAAGCCTCTGCCTGG - Intergenic
999232657 5:150070607-150070629 AGCCTAGTATGGCCCCTGCCAGG + Intronic
999917707 5:156281521-156281543 TAATTATTGAGGCCCCTGCCAGG + Intronic
1005979793 6:30828219-30828241 TTACTATGCAGTCCCCTGCCCGG - Intergenic
1013148147 6:107415416-107415438 GTACTAGTAAGGCCTCTTCTAGG + Intronic
1025019848 7:55472445-55472467 TTAATAGGAAGCCCCATGCCGGG - Exonic
1033176840 7:139132541-139132563 TCACTAGGAAGGCCCCTTCCTGG - Intergenic
1034590674 7:152136424-152136446 TTCATAGGAAGGCCCCTGCCCGG + Exonic
1039624639 8:39036231-39036253 TTTCTAGAAAGGCACCTCCCAGG - Intronic
1049457232 8:142699930-142699952 TTACTAGTAAGGCCCCTGCCTGG - Intergenic
1049915740 9:316647-316669 TTACTAGTAAAGCCCTTGACAGG + Intronic
1059655744 9:116355692-116355714 TTACTTGGAAGGCCCCAGGCAGG - Intronic
1062017036 9:134296162-134296184 TTCCAAGCAAGGCCCCTACCAGG - Intergenic
1192245894 X:69371320-69371342 TTACTAGGAAAGCCCCTGCCAGG - Intergenic
1197941932 X:131799867-131799889 TTTCTAGTAAGCCCAATGCCTGG + Intergenic