ID: 1049460903

View in Genome Browser
Species Human (GRCh38)
Location 8:142727281-142727303
Sequence GGTGCCGGTGTCCGCGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049460903_1049460917 28 Left 1049460903 8:142727281-142727303 CCAGCGCCGCGGACACCGGCACC 0: 1
1: 0
2: 2
3: 20
4: 183
Right 1049460917 8:142727332-142727354 CCCGCCGCCGCCGCTATGCTGGG 0: 1
1: 0
2: 2
3: 13
4: 115
1049460903_1049460915 27 Left 1049460903 8:142727281-142727303 CCAGCGCCGCGGACACCGGCACC 0: 1
1: 0
2: 2
3: 20
4: 183
Right 1049460915 8:142727331-142727353 GCCCGCCGCCGCCGCTATGCTGG 0: 1
1: 0
2: 2
3: 20
4: 120
1049460903_1049460908 -3 Left 1049460903 8:142727281-142727303 CCAGCGCCGCGGACACCGGCACC 0: 1
1: 0
2: 2
3: 20
4: 183
Right 1049460908 8:142727301-142727323 ACCGGCGCCACGGACTCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 55
1049460903_1049460919 29 Left 1049460903 8:142727281-142727303 CCAGCGCCGCGGACACCGGCACC 0: 1
1: 0
2: 2
3: 20
4: 183
Right 1049460919 8:142727333-142727355 CCGCCGCCGCCGCTATGCTGGGG 0: 1
1: 0
2: 1
3: 27
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049460903 Original CRISPR GGTGCCGGTGTCCGCGGCGC TGG (reversed) Exonic