ID: 1049461765

View in Genome Browser
Species Human (GRCh38)
Location 8:142733019-142733041
Sequence ATGACCCTGTTTCCTTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 95, 2: 63, 3: 50, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049461765_1049461773 28 Left 1049461765 8:142733019-142733041 CCCAACAAAGGAAACAGGGTCAT 0: 1
1: 95
2: 63
3: 50
4: 256
Right 1049461773 8:142733070-142733092 CGTCTCTGGTTTCCATTGACTGG No data
1049461765_1049461768 14 Left 1049461765 8:142733019-142733041 CCCAACAAAGGAAACAGGGTCAT 0: 1
1: 95
2: 63
3: 50
4: 256
Right 1049461768 8:142733056-142733078 GTCCACCCTATTGCCGTCTCTGG No data
1049461765_1049461774 29 Left 1049461765 8:142733019-142733041 CCCAACAAAGGAAACAGGGTCAT 0: 1
1: 95
2: 63
3: 50
4: 256
Right 1049461774 8:142733071-142733093 GTCTCTGGTTTCCATTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049461765 Original CRISPR ATGACCCTGTTTCCTTTGTT GGG (reversed) Intronic
900075241 1:810092-810114 ATGGTCCTTTTTCCTTTTTTTGG + Intergenic
902044837 1:13516454-13516476 ATGGCTCTGTTTTATTTGTTGGG - Intergenic
903253071 1:22070885-22070907 ATGACCCTGTCTCCTTTGCTCGG + Intronic
903327183 1:22576135-22576157 ATGACCCTGTGTTCTGTGCTGGG - Intronic
903819829 1:26093775-26093797 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
905237753 1:36561730-36561752 AAGACCCTGTAGCCTCTGTTAGG - Intergenic
905536408 1:38725712-38725734 ATTACCCTGTCTCCTTTGTTAGG + Intergenic
906883690 1:49621253-49621275 ATGACCCTGTCTCCTTTGTTGGG - Intronic
906932257 1:50181544-50181566 ATGACCCAGTTTCCTAAGTGGGG - Intronic
907510876 1:54957709-54957731 ATAACTCTGTCTCCTTTGTTCGG + Intergenic
908502346 1:64756823-64756845 ATGACCCTGATGGTTTTGTTTGG + Intronic
908781084 1:67690775-67690797 ATGACCCTTTTTTCTTTATTTGG - Intergenic
909061243 1:70881719-70881741 ATGACTGTGTTTCTTTTGTTGGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
910678822 1:89842364-89842386 CTGACCCTGTTTCCTCACTTGGG + Intronic
911032537 1:93505330-93505352 ATGACCCTGTCTCCTTTGTTCGG - Intronic
911038320 1:93572540-93572562 ATCACCCTGCTTCCTGTTTTGGG - Intronic
911283102 1:95955875-95955897 ATGACCATGTCTCCTTTGTTCGG + Intergenic
911422235 1:97657671-97657693 ACGCCCGTGGTTCCTTTGTTAGG - Intronic
913365303 1:118031284-118031306 ATGAAACTGTTTCCATTGTTTGG + Intronic
914438034 1:147677930-147677952 ATAACCTTGTCTCCTTTGTTCGG - Intergenic
915557727 1:156669661-156669683 CTGACCCTGTTTCCTTGGAGAGG - Exonic
915835434 1:159171931-159171953 AGGAGCCTGTTGGCTTTGTTTGG + Intronic
915959354 1:160251919-160251941 ATGACACTGTCTCCTCTGGTAGG + Intronic
917077396 1:171219661-171219683 ATGACCCTGCCTCCTTTGTTTGG + Intergenic
918402684 1:184179450-184179472 ATGACCATATTTCTTTGGTTTGG + Intergenic
919406559 1:197191538-197191560 ATTATCCTGTTTTCTTTCTTGGG - Intronic
919550652 1:198982088-198982110 AAGACACTGTTTCCTATCTTGGG - Intergenic
921342088 1:214144460-214144482 ATGACCCCGTCTCCTTTGTTTGG - Intergenic
921740668 1:218681157-218681179 GTGTGACTGTTTCCTTTGTTTGG - Intergenic
921793913 1:219320751-219320773 ATGAGTTTGTTTCCTTTGTAGGG - Intergenic
922238659 1:223740373-223740395 ATGACCCTGTCTCCTTTGTTTGG - Intronic
922976705 1:229790880-229790902 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
923309094 1:232717901-232717923 ATTACCCTGTCTCCTTTGTTCGG - Intergenic
923329977 1:232914224-232914246 ATGACCCCGTGTCCTTTGTTCGG - Intergenic
923357780 1:233177477-233177499 ATGACCCTGTCTCCTTTGTTTGG + Intronic
924952436 1:248897370-248897392 ATGACCCTGTCTTCTTTGTTTGG + Intergenic
924956612 1:248934361-248934383 GTAACTCTGTCTCCTTTGTTTGG - Intergenic
1062807493 10:434870-434892 ATTACTCTGGTTTCTTTGTTGGG + Intronic
1063026998 10:2189630-2189652 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
1064321246 10:14306997-14307019 ATGTCCCTGGTTCCTATGTTAGG - Intronic
1066241844 10:33544610-33544632 ATTATACTGTTTCGTTTGTTGGG - Intergenic
1066247852 10:33601152-33601174 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
1066263942 10:33756854-33756876 AGGATCCTGTTTTCTTTGTTTGG + Intergenic
1066614782 10:37283512-37283534 AGGACTCTGTTACCTTTTTTAGG - Intronic
1067059945 10:43073159-43073181 AGGCCCCTGTTGCTTTTGTTCGG + Intergenic
1068135167 10:52945920-52945942 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1069213620 10:65792333-65792355 ACAACCCTGTCTCCTTTGTTTGG - Intergenic
1069450824 10:68516207-68516229 ATGACCCTGTCTCCTTTGTTCGG - Intronic
1069452714 10:68529992-68530014 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1073293523 10:102424960-102424982 CTGTCCCTGTCACCTTTGTTGGG - Intronic
1073852723 10:107639637-107639659 ATGAGTTTGTTTCCTTTGCTTGG + Intergenic
1074020729 10:109579898-109579920 AGGACTCTGTTTCCTTAGTGTGG + Intergenic
1075256793 10:120931713-120931735 ATGACCCTGGTGCCATTGTCAGG - Intergenic
1075779674 10:125009105-125009127 ATGACCCTGTGTCCTTTGTTGGG + Intronic
1076430245 10:130396811-130396833 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1076565943 10:131399354-131399376 ATGACCCTGCCTCCTTTGTTCGG - Intergenic
1076654607 10:132015395-132015417 ATGACCCTGCCTCCTTTGTTCGG - Intergenic
1076962506 10:133776042-133776064 GTAACTCTGTCTCCTTTGTTTGG - Intergenic
1078044279 11:7899248-7899270 ATAACCCTGTCTCCTTTGTTCGG - Intergenic
1078073810 11:8138974-8138996 ATGACCCTGTCTCCTTTGTTCGG + Intronic
1078221896 11:9358249-9358271 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1079900294 11:26174612-26174634 ATGTCCCTTTGTCCTTTGTAGGG + Intergenic
1080766821 11:35304926-35304948 ATGGCCTTGTCTCCTTAGTTGGG - Intronic
1080962886 11:37180859-37180881 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1082633694 11:55570639-55570661 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1084213974 11:67637416-67637438 ATGACCCTGTCTCCTTTGTTCGG - Intronic
1084980959 11:72828527-72828549 CTGACCCTGTGGCCTTTGCTGGG + Intronic
1085918480 11:80921769-80921791 ATGACACTGTCTCCTTTGTTCGG + Intergenic
1086529494 11:87767604-87767626 ATGACCCTTTTTTTTTGGTTGGG - Intergenic
1087140364 11:94759839-94759861 ATGTGCCTGTTTCCTTATTTAGG + Intronic
1087223268 11:95569305-95569327 ATAACTTTGTCTCCTTTGTTTGG + Intergenic
1087425140 11:97976085-97976107 ATGACCCTGTCTCCTTTGTTTGG - Intergenic
1090818836 11:130322370-130322392 ATAACCCTGTCTCCTTTGTTCGG - Intergenic
1092629415 12:10362505-10362527 ATGATGCTGTCTCCTTTGTTTGG + Intergenic
1092630596 12:10372105-10372127 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1093211077 12:16309760-16309782 ATAACTCTGTCTCCTTTGTTTGG - Intergenic
1093557770 12:20497527-20497549 ATGATCCTGTTTTTTTTTTTAGG - Intronic
1095260271 12:40090693-40090715 ATGACTTTGTTACATTTGTTTGG - Intronic
1095465859 12:42487522-42487544 CTGACCCTCCTTCCTTTGTGAGG + Intronic
1095921481 12:47535794-47535816 ATGACCATGTTGTCTTTTTTTGG - Intergenic
1096271640 12:50170281-50170303 ATAACTCTGTCTCCTTTGTTCGG - Intergenic
1097062048 12:56292515-56292537 ATGACCCTGTCTCCTTTGCTCGG + Intronic
1098769935 12:74539538-74539560 ATGTCCCTGTTTTCTTTGGTTGG + Exonic
1098836834 12:75433835-75433857 ATTACTCTGTCTCCTTTGTTTGG + Intergenic
1099450881 12:82805009-82805031 ATGACCCTGTCTCCTTTGTTTGG - Intronic
1100455333 12:94746150-94746172 CTGACTCTGTTACCTTCGTTTGG - Intergenic
1100572303 12:95854282-95854304 AATACCAGGTTTCCTTTGTTGGG + Intergenic
1101561119 12:105859115-105859137 ATGCCCTTGTTTCCTTCTTTAGG - Intergenic
1101648648 12:106654712-106654734 ATGGCCCTGTATCCTTAGATTGG + Intronic
1102217932 12:111174730-111174752 ATGTCCCTGTTCCCTTTGTCTGG - Intronic
1102243557 12:111340977-111340999 ATGACCCTGTCTCCTTTGTTCGG + Intronic
1102292439 12:111712147-111712169 ATGACCCTGTCTCCTTTGTTTGG + Intronic
1103767789 12:123294043-123294065 ATCAGCCAGTTTCCCTTGTTAGG - Exonic
1104157486 12:126147816-126147838 ATGACCTTGTTTTCCTTGGTCGG - Intergenic
1104188321 12:126454001-126454023 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1105309119 13:19190530-19190552 AGCACCCTGCTTCCTTTGTAGGG + Intergenic
1105457499 13:20554881-20554903 ATGAACGTGTTTCCCTTCTTGGG + Intergenic
1105528483 13:21197615-21197637 AGCACCCTGCTTCCTTTGTAGGG - Intergenic
1106619502 13:31359890-31359912 ATGACTCTTTTTCCTTTGGGTGG + Intergenic
1107728540 13:43324732-43324754 AGGAGCCTGCTTGCTTTGTTTGG - Intronic
1109142090 13:58726641-58726663 ATGACCTATTTTCCTTAGTTTGG - Intergenic
1109361142 13:61296460-61296482 ATGAGTCTGTTTACCTTGTTAGG + Intergenic
1109934537 13:69264477-69264499 GTGCCCATGTTTCTTTTGTTTGG + Intergenic
1111540539 13:89662002-89662024 AGGACCCTTTGTCCTTTGCTTGG - Intergenic
1112518535 13:100077132-100077154 ATGTCCTTGTCTCCTTTGTTTGG - Intergenic
1112929514 13:104716337-104716359 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
1113989007 13:114343946-114343968 GTAACTCTGTCTCCTTTGTTTGG - Intergenic
1114396065 14:22362924-22362946 ATGCCCAAGTTTCCTTTGTTAGG + Intergenic
1114683351 14:24505795-24505817 ATGCCCCTTCTTCCTTTCTTGGG + Intronic
1115392103 14:32865812-32865834 GTGCCCATGTTTCTTTTGTTGGG + Intergenic
1115419100 14:33172072-33172094 ATGTCACTGTTACATTTGTTTGG - Intronic
1116159490 14:41250996-41251018 CTGAACTTGTTTCCTTTATTCGG - Intergenic
1116250512 14:42475855-42475877 AAGACCCTGTTTTTTTTGTTTGG + Intergenic
1117175624 14:53143475-53143497 ATGACCCTGTCTCCTTTGTTTGG - Intronic
1117180257 14:53184089-53184111 ATGACCCTGTCTCCTTTGTTTGG - Intergenic
1118173193 14:63410246-63410268 TTTACCCTGTTTCTTTTCTTTGG - Intronic
1118332860 14:64827222-64827244 AGGATGCTGTTTACTTTGTTGGG - Intronic
1118456660 14:65951044-65951066 ATGAACTTTTTTCTTTTGTTTGG - Intergenic
1119135562 14:72215510-72215532 ATGACCCTGCCTCTTTTGTTTGG - Intronic
1120038884 14:79729763-79729785 TTGAGCCTGTTTCTTTTATTTGG + Intronic
1120090196 14:80322818-80322840 AGGTCTCTGTTTCCTTAGTTTGG - Intronic
1121975211 14:98397089-98397111 ATTACTCTCTTTCCTTTGTTGGG - Intergenic
1122452781 14:101824527-101824549 GTAACCCTGTGTCCTTTGTTGGG + Intronic
1123832278 15:24152792-24152814 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1123838065 15:24216473-24216495 ACGACCATGTCTCCTTTGTTCGG + Intergenic
1123881759 15:24683299-24683321 ATGACCCTGTCTCCTTTGTTCGG + Exonic
1124238312 15:28008602-28008624 ATGACCCTGTCTCCTTTGTTTGG + Intronic
1124648647 15:31458382-31458404 GGGATCCTGTTTCCTTTGATTGG + Intergenic
1124838002 15:33214145-33214167 TTGTCCCTGTTTCCATTTTTAGG + Intergenic
1125235666 15:37510860-37510882 GTTCCCCAGTTTCCTTTGTTGGG + Intergenic
1125367629 15:38935572-38935594 ATCACCCTGTATCTTTTCTTAGG + Intergenic
1125433732 15:39624732-39624754 AGGACCCTTTGTCCTTGGTTTGG - Intronic
1125709858 15:41775681-41775703 ATGACTCAGTTTCCCTTCTTGGG + Intronic
1125744836 15:41991041-41991063 ATGACCCTGTTTTCTTTCAAAGG - Intronic
1126059748 15:44768948-44768970 CTGTCCCTATTTCCTTTCTTTGG + Intergenic
1126287291 15:47027571-47027593 ATGCCTGTGTTTCCTTTGTTAGG - Intergenic
1126492225 15:49250056-49250078 ATGACTCTGTCTCCTTTGTTTGG + Intronic
1126572361 15:50165425-50165447 ATGAACATGTTTCTTTTGTGTGG + Intronic
1127889120 15:63232749-63232771 ATGCCCCGTTTTCCTCTGTTGGG + Intronic
1127950001 15:63795726-63795748 ATGACCCTGTCTCTTTTGTTCGG - Intronic
1129036293 15:72650533-72650555 AAGATCCTGCTGCCTTTGTTAGG - Intergenic
1129213596 15:74086691-74086713 AAGATCCTGCTGCCTTTGTTAGG + Intergenic
1129396806 15:75254394-75254416 AAGATCCTGCTGCCTTTGTTAGG - Intergenic
1129400416 15:75278671-75278693 AAGATCCTGCTGCCTTTGTTAGG - Intronic
1129474034 15:75771379-75771401 AAGATCCTGCTGCCTTTGTTAGG - Intergenic
1129730731 15:77931015-77931037 AAGATCCTGCTGCCTTTGTTAGG + Intergenic
1130139753 15:81215596-81215618 GTGCCCGTGTTTCTTTTGTTAGG + Intronic
1131010373 15:89012460-89012482 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
1131187511 15:90287404-90287426 AAGATCCTGCTGCCTTTGTTAGG - Intronic
1134027918 16:10968470-10968492 ATCACCCAGTTTTCATTGTTGGG + Intronic
1134676643 16:16095309-16095331 ATGACTCTGGTTTCTTTCTTAGG + Intronic
1135810006 16:25578412-25578434 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1136671570 16:31863253-31863275 ATGACCTTGTTTCTGTTGGTGGG - Intergenic
1138687288 16:58736562-58736584 GTGACCTTGTCTCCTTTGTTTGG + Intergenic
1138795669 16:59965592-59965614 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1139589492 16:67925701-67925723 ATGACCCTGTTAGGTGTGTTTGG + Intronic
1139771238 16:69279304-69279326 ATGACAGTATTTCCTTTTTTAGG + Intronic
1140865035 16:79052692-79052714 ATGAGCCTGTCTCCTTTGTCCGG + Intronic
1141587474 16:85044403-85044425 TTGACAATGTTTCCTTTCTTGGG + Intronic
1141633011 16:85299048-85299070 GTGACCCTGGTTCCTCTGTGGGG + Intergenic
1144102855 17:11959570-11959592 AAAAAACTGTTTCCTTTGTTTGG - Intronic
1148177191 17:45577056-45577078 ATGACCCTATCTCCTTTGTTGGG + Intergenic
1150096127 17:62377343-62377365 ATAACTCAGTTTCCTATGTTTGG - Intronic
1150720682 17:67611800-67611822 ATGAGCCTGTTGCCTTTTATTGG + Intronic
1152294806 17:79460635-79460657 ATGACCTCATTACCTTTGTTAGG - Intronic
1152720827 17:81923154-81923176 AAGGCCTTGTTTCCTTTATTGGG + Exonic
1152816885 17:82412988-82413010 ATGACCTTGGTTCCTTTCTCTGG + Intronic
1152951620 17:83237706-83237728 GTAACTCTGTCTCCTTTGTTTGG - Intergenic
1153582031 18:6582885-6582907 ATGCCTCTGTTTCTTTTGTTAGG - Intronic
1155476311 18:26238519-26238541 AGGACTCTGTTTCCTTCTTTAGG - Intronic
1155690565 18:28617063-28617085 CTTACCCTGTTTCCTTTCTGTGG + Intergenic
1155752966 18:29452597-29452619 ATTTCCCTGTTTCCTTTTATTGG - Intergenic
1155938177 18:31775990-31776012 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1157331981 18:46710787-46710809 AGGGCCATGTTTCCTTTCTTGGG + Intronic
1157895215 18:51460161-51460183 ATGTCCTGTTTTCCTTTGTTGGG + Intergenic
1159027573 18:63200060-63200082 ATGTTCCTGTTTTGTTTGTTTGG + Intronic
1160221261 18:76979691-76979713 AAGACCCTGTTTCCTATGTGAGG + Intronic
1160633119 18:80260522-80260544 GTAACTCTGTCTCCTTTGTTTGG - Intergenic
1161771670 19:6234176-6234198 ATGCCACTGTTTCCTGTGTGAGG - Intronic
1162265958 19:9574523-9574545 ATGAACCTGTCTCCTTTGTTCGG - Intronic
1162271876 19:9622525-9622547 ATGACCCTATCTCCTTTGTTTGG - Intronic
1163210682 19:15837474-15837496 ATGACCCTGTCTCCTTTGCTCGG - Intergenic
1163927261 19:20357538-20357560 GTGACCCTGTCTCCTTTGTTCGG - Intergenic
1164014146 19:21237193-21237215 ATGACCCTGTCTCCTTTGTTTGG + Intronic
1164453388 19:28386043-28386065 CTGACCCTATTTCATCTGTTGGG + Intergenic
1164523084 19:28993727-28993749 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
1165109185 19:33491576-33491598 ACGACCCTGTCTCCTTTGTTTGG - Intronic
1165294737 19:34917392-34917414 ATGACCCTGTCTCCTTTGTTTGG - Intergenic
1166411611 19:42559261-42559283 ATGACCCTGTCTCCTTTGTTCGG - Intronic
1167535993 19:50051876-50051898 ATAACTCTGTCTCCTTAGTTTGG + Intronic
1168025929 19:53643579-53643601 ATGACCCTCTCCCCCTTGTTGGG + Intergenic
1168727651 19:58596746-58596768 GTAACTCTGTCTCCTTTGTTTGG - Intergenic
925229428 2:2219794-2219816 ATGACCCTGTCTCCTTTTTTCGG + Intronic
925841907 2:7999963-7999985 ATGACACTGTTGCCTTTGGATGG - Intergenic
926288882 2:11512917-11512939 ATGACCTTCTTTCAGTTGTTGGG + Intergenic
926686777 2:15704252-15704274 ATCAGCCTCATTCCTTTGTTTGG - Intronic
926704535 2:15827293-15827315 ATGACTCTGTTTACCTTGGTGGG - Intergenic
930650726 2:53961830-53961852 ATGACCCTGTCTCCTTTGTTGGG - Intronic
930786996 2:55280884-55280906 ATGACCCTGTCTCCTTTGTTGGG - Intergenic
931404290 2:61961217-61961239 ATAACTCTGTCTCCTTTGTTTGG - Intronic
931451731 2:62373074-62373096 GTGACCCTGTCTCCTTTGTTCGG - Intergenic
931561694 2:63568577-63568599 ATGACCCTGTCTCCTTTGTTTGG - Intronic
931721038 2:65068065-65068087 ATGGCCTTGTTTCCTTAGTCAGG - Intronic
931818997 2:65932956-65932978 GTGGCCCTGTTTCCATTCTTAGG + Intergenic
933181774 2:79235497-79235519 ATGCCCATATTTCTTTTGTTAGG + Intronic
933988109 2:87610766-87610788 ATGAAACTGTCTCCTTTTTTAGG + Intergenic
934916859 2:98307259-98307281 ATGACCCTGTCTCCTTTGTTCGG - Intronic
935044763 2:99470801-99470823 ATGACCCGGTCTCCTTTGTTCGG + Intronic
935079769 2:99781119-99781141 AGGAACCTGTTTGGTTTGTTTGG - Intronic
935480798 2:103586347-103586369 ATGACCCTATATATTTTGTTTGG - Intergenic
936275959 2:111097511-111097533 AGGACCCTGGTTCCTTTTATTGG - Intronic
936305731 2:111340042-111340064 ATGAAACTGTCTCCTTTTTTAGG - Intergenic
936570907 2:113614448-113614470 GTAACTCTGTCTCCTTTGTTTGG + Intergenic
937726596 2:125174570-125174592 ATCACCCTGTCTCCTTTGTTTGG + Intergenic
937819142 2:126288180-126288202 ATGAAGCTGTTTTCTTTGGTAGG + Intergenic
938126957 2:128681334-128681356 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
938747640 2:134294986-134295008 ATGACCCTGCCTCCTTTGTTCGG + Intronic
939039250 2:137168152-137168174 ATGTGCCTTTTTCCCTTGTTAGG + Intronic
939505130 2:143036283-143036305 ATGACCCTGTCTCCTTTGTTCGG - Intronic
939731577 2:145791094-145791116 ATGACCATTTTTCTCTTGTTTGG - Intergenic
940748075 2:157593354-157593376 ATTACTACGTTTCCTTTGTTTGG + Intronic
943322175 2:186458059-186458081 AAGAACCTGTTTCCTTTTTAGGG - Intergenic
943637955 2:190326829-190326851 ATGACCCAGGTCTCTTTGTTTGG - Intronic
944240845 2:197483674-197483696 ATGACCCTGTCTCTTTTGTTCGG + Intergenic
945007348 2:205422916-205422938 ATGAGGATGTTTCATTTGTTAGG - Intronic
945204888 2:207320783-207320805 GAGACCCTGTTTCCTTTTATTGG - Intergenic
945573244 2:211497603-211497625 ATGTGCCTGTTTCCTTTGTGTGG - Intronic
945656356 2:212628554-212628576 ATAACTCTGTCTCCTTTGTTCGG - Intergenic
945755775 2:213844752-213844774 ATGACATTGTTTCCTTTCATTGG - Intronic
947029078 2:225772228-225772250 ATCACCTTGTTTCCTTTGGAGGG + Intergenic
947165270 2:227255276-227255298 ATTGCCCTATTTCCTTTGTGGGG - Intronic
947513939 2:230784835-230784857 ATAACTCTGTCTCCTTTGTTCGG - Intronic
948266083 2:236636142-236636164 ATGACCCTCTGGCCTTTCTTGGG - Intergenic
948992262 2:241561175-241561197 ATTACCCTGTTTGCTTTGGCTGG + Intronic
1168900990 20:1364824-1364846 ATGACCCTGTCTCCTTTGTTCGG + Intronic
1170520599 20:17180562-17180584 GTGCCCATGTTTCTTTTGTTGGG - Intergenic
1170681099 20:18526382-18526404 ATGATCCTGGCTCCTGTGTTTGG - Exonic
1170709461 20:18777258-18777280 ATAACGCTATCTCCTTTGTTCGG + Intergenic
1171013215 20:21519767-21519789 ATGACCCTGTTTCCTTCTCCGGG - Intergenic
1173880955 20:46411931-46411953 ATGACCATGTTGCCCTTCTTTGG + Intronic
1174334540 20:49849606-49849628 ATCACCCTGTTTGCTGTTTTTGG + Exonic
1174722101 20:52823822-52823844 ATGCTCATGTTTGCTTTGTTGGG - Intergenic
1176974058 21:15298487-15298509 ATGACCCTACTTCCTGTGTGAGG + Intergenic
1177542980 21:22520059-22520081 TTGACCCAGTTTTCTTTCTTAGG - Intergenic
1177604251 21:23358277-23358299 ACGACCCTGTCTCCTTTGTTTGG - Intergenic
1178666204 21:34549168-34549190 ATGAGCATGTGTGCTTTGTTTGG + Intronic
1178862583 21:36301629-36301651 ATGACCCTGTCTCCTTTGTTTGG - Intergenic
1179016327 21:37596950-37596972 ATGATCCCGTCTCCTTTGTTTGG + Intergenic
1179317640 21:40258911-40258933 ACGACCCTGTCTCCTTTGTTTGG + Intronic
1179317743 21:40259842-40259864 ATGACCCTGTCTCCTTTGTTCGG + Intronic
1179651574 21:42812800-42812822 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1180263090 21:46688548-46688570 GTAACTCTGTCTCCTTTGTTTGG - Intergenic
1180659640 22:17454940-17454962 ATGACCCTGTCTCCTTTGTTCGG - Intronic
1181381757 22:22510077-22510099 ATAACCCTGTATCCTTTGTTTGG - Intergenic
1182537715 22:31017816-31017838 GTAACTCTGTCTCCTTTGTTCGG - Intergenic
1182729083 22:32473147-32473169 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1183255945 22:36762218-36762240 AGGAACCTGCTTCCTGTGTTTGG - Intronic
1185429295 22:50796432-50796454 GTAACTCTGTCTCCTTTGTTTGG - Intergenic
949093042 3:51766-51788 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
949127237 3:460870-460892 TTCACCCAGTTTCCTTTCTTGGG + Intergenic
949726839 3:7058710-7058732 ATGACCCTGTCTCCTTTGTTCGG - Intronic
950084159 3:10245440-10245462 ATGACCCTGTCTCCTTTGTTGGG + Intergenic
950532314 3:13559335-13559357 ATGACCCTGTTTCTCTTTCTTGG + Intronic
951319132 3:21223942-21223964 AGGATTTTGTTTCCTTTGTTTGG + Intergenic
951758460 3:26118198-26118220 GTGCCCGTGTTTCTTTTGTTAGG - Intergenic
952941176 3:38445361-38445383 ATGACTCTGTTCCCTTCTTTAGG - Intergenic
954588121 3:51754480-51754502 ACGACCCTGTCTCCTTTGTTCGG - Intergenic
956871548 3:73422925-73422947 ATACCTCTGTTTCCTTTGCTTGG - Intronic
957033305 3:75267865-75267887 ATAACCCTGTCTCCTTTGTTCGG + Intergenic
957220272 3:77373752-77373774 ATGACCCTTTTTCCTTCCTTTGG - Intronic
957480886 3:80791916-80791938 ATGCCCCTTTTTCCATTGATGGG - Intergenic
958018794 3:87972820-87972842 ATCACCTTGTTTCATTTTTTTGG + Intergenic
958939801 3:100299140-100299162 ATGAACTTGTTCCCTTTATTTGG + Intronic
959195313 3:103173091-103173113 AAGATACTGTTTTCTTTGTTTGG + Intergenic
960118960 3:113927323-113927345 GTGCCCATGTTTCTTTTGTTGGG + Intronic
961723427 3:128910522-128910544 CTGACCCTGTTTCCTCTGAAAGG - Intronic
963677335 3:148328651-148328673 TTGGCTGTGTTTCCTTTGTTGGG + Intergenic
965820376 3:172678971-172678993 ATGACCCTGCCTCCTTTGTTCGG - Intronic
966167823 3:177041040-177041062 TTGACTATGTTTACTTTGTTGGG - Intronic
966368924 3:179225265-179225287 ATGTCCCTCTTTTCTCTGTTAGG - Intronic
968373439 4:16754-16776 GTAACTCTGTCTCCTTTGTTCGG + Intergenic
968455242 4:694736-694758 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
969084260 4:4643833-4643855 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
969783805 4:9435418-9435440 ATGACTCTGTGTCCTTTGTAGGG - Intergenic
970141926 4:12992664-12992686 ATGACTATGTTTTCTTTGTGAGG + Intergenic
971576235 4:28279126-28279148 ATGAACATGTTTCCTTGTTTGGG + Intergenic
971578263 4:28304106-28304128 AGGACTCTGTTTCCTTCTTTAGG + Intergenic
971581115 4:28342162-28342184 ATGTCCCTGTCTCCTTTGTTTGG + Intergenic
971600529 4:28585896-28585918 ATGAGCCTGTCTCCTTTGTTTGG + Intergenic
971671940 4:29571856-29571878 TTTACCCTGTTTTATTTGTTTGG - Intergenic
971723932 4:30283677-30283699 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
971778300 4:30996476-30996498 ATTTTCCTCTTTCCTTTGTTTGG - Intronic
973669181 4:53197427-53197449 ATGGCCCTTTTTCCTCTTTTGGG - Intronic
974078335 4:57188289-57188311 AGGACCATGTTTCCTTCATTAGG + Intergenic
974416127 4:61608680-61608702 ATGTCTCTGTTTTCTTTTTTGGG + Intronic
974621660 4:64363466-64363488 ATGACCCTGTCTCCTTTGTTGGG - Intronic
974980814 4:68955242-68955264 ATGACCCTGTATCCTCTGTTTGG + Intergenic
975007870 4:69312979-69313001 ATGTCCCTGTCTCCTTTGTTCGG + Intronic
975023135 4:69515818-69515840 ATAATGCTGTTTTCTTTGTTTGG - Intronic
975747647 4:77490595-77490617 ATTACTCTGATTCATTTGTTGGG - Intergenic
976579946 4:86724479-86724501 AAAAACCTGTTTCCTTTTTTAGG + Intronic
977066295 4:92320253-92320275 AAAACACTGTTTCCTTTTTTAGG - Intronic
977072138 4:92404697-92404719 ATGATCTTGTTTCCTTTTTATGG - Intronic
977608997 4:99013550-99013572 ATGTCCCCGTCTCCTTTGTTTGG - Intronic
977610022 4:99021631-99021653 ATGTCCCTGTCTCCTTTGTTTGG - Intronic
977616443 4:99091858-99091880 ATGACCCTGTCTCCTTTGTTTGG - Intergenic
977651335 4:99473073-99473095 CTGACGTTGTTTGCTTTGTTGGG - Intergenic
978366456 4:107988192-107988214 ATGACCCTGCCTCCTTTGTTCGG + Intergenic
978369078 4:108012446-108012468 ATGACCCTGTCTCCTTTGTTCGG - Intronic
978471331 4:109070846-109070868 ATGAGCTCGTGTCCTTTGTTGGG - Intronic
979100504 4:116606227-116606249 ATGGCCCTGTCACCTTTGTTCGG - Intergenic
980004855 4:127530262-127530284 ATGACCCTGTCTCCTTCATTGGG + Intergenic
980742427 4:136970015-136970037 AACGCCCTTTTTCCTTTGTTGGG - Intergenic
983383741 4:167030575-167030597 ATTAGCCTGTTTACATTGTTTGG + Intronic
984079914 4:175235052-175235074 GTGACCACTTTTCCTTTGTTTGG - Intergenic
984940062 4:184923167-184923189 ATGACCCTATCTCCTTTGTTCGG + Intergenic
985461957 4:190115802-190115824 GTAACTCTGTCTCCTTTGTTCGG - Intergenic
985465738 4:190193522-190193544 GTAACTCTGTCTCCTTTGTTTGG - Intergenic
986161059 5:5229429-5229451 ATGACCTTGTATCCTTTGTTCGG + Intronic
986283011 5:6338929-6338951 TGGACCCTTTGTCCTTTGTTGGG - Intergenic
986594885 5:9411132-9411154 CTGACCCTGTTTCTTTTGCCTGG - Intronic
987312790 5:16697048-16697070 ATGACATTTTTTCCTTTGTCAGG + Intronic
987583608 5:19825576-19825598 GTGTCCATGTTTCTTTTGTTAGG - Intronic
990588153 5:57232716-57232738 ATGACCCTGTCTCCTTTGTTCGG + Intronic
990755183 5:59060948-59060970 ATAACACTGCTTCCATTGTTGGG + Intronic
991090713 5:62691216-62691238 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
991137409 5:63198188-63198210 ATGACTCTTTTTCCTTTGGGTGG - Intergenic
991192184 5:63887546-63887568 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
992624502 5:78625047-78625069 AAGACCTGGTTTCCTTGGTTGGG + Intronic
992745462 5:79816023-79816045 AAGTCCCTGTTTCTTTAGTTAGG + Intergenic
993562268 5:89424763-89424785 TTGAACTTGTTTCATTTGTTGGG + Intergenic
993966555 5:94366830-94366852 ATGACCCTGTCTCCTTTGTTTGG - Intronic
995185759 5:109268146-109268168 ATGAGCCTGTATCCTATGTCTGG - Intergenic
995912112 5:117200023-117200045 ATGCCCCTGTTTCATTAATTTGG - Intergenic
996306395 5:122053039-122053061 ATGCCCATGTTTCTTTTGTTGGG + Intronic
996483501 5:124002647-124002669 AAAATCCTGTTTCTTTTGTTTGG + Intergenic
996865607 5:128118223-128118245 ATGACTTATTTTCCTTTGTTTGG - Intronic
997408511 5:133671596-133671618 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
997420363 5:133762254-133762276 AAGACCCTCTTTGCATTGTTGGG - Intergenic
997535022 5:134613245-134613267 ATGACCCTGTCTCCTTTGTTCGG + Intronic
999347535 5:150837406-150837428 ATGACCTTGTCTTCTTTGTTCGG - Intergenic
999833857 5:155348016-155348038 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1001423558 5:171606519-171606541 ATAACCCTGGTTCCTTTTATTGG + Intergenic
1001845899 5:174921294-174921316 AAGATCCTGCTGCCTTTGTTAGG + Intergenic
1002491490 5:179581113-179581135 ATGACCCTTTTGTCTTGGTTTGG - Intronic
1005788592 6:29273011-29273033 GTCACCCTATTTCTTTTGTTTGG + Intergenic
1006412253 6:33880980-33881002 ATGACCCTGTCTCCTTCGTTCGG + Intergenic
1006483135 6:34314666-34314688 ATCACCCTATTACCGTTGTTAGG - Intronic
1008029987 6:46684804-46684826 ATGAGCATGTTTCCTTTCTTTGG + Intergenic
1008356650 6:50562551-50562573 ATTACGTTGTTTCCTTTGCTTGG - Intergenic
1010144956 6:72657564-72657586 AAGACCCTGTTTCTTTCCTTAGG - Intronic
1010810046 6:80290362-80290384 GTGCCCATGTTTCTTTTGTTAGG - Intronic
1010852969 6:80800802-80800824 ATGAGTTTGTGTCCTTTGTTGGG - Intergenic
1011455052 6:87539696-87539718 ATGACCCTGTCTCCTTTGTTCGG + Intronic
1011626140 6:89285358-89285380 ATGACTCTTTTTCCCTTGGTGGG + Intronic
1014110513 6:117615710-117615732 ATAACCCTGTCTCCTTTGTTCGG + Intergenic
1014164446 6:118207818-118207840 AAGACCTTTTTTCCATTGTTAGG + Intronic
1015300156 6:131643900-131643922 ACGACCCTGATTCCTTCTTTTGG - Intronic
1016536430 6:145111823-145111845 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1018136984 6:160788551-160788573 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
1018193441 6:161332132-161332154 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1018251025 6:161870510-161870532 ATGCCACTGTTTCCTTTTGTTGG + Intronic
1018314419 6:162542834-162542856 ATGACCCTCTACCCTCTGTTGGG - Intronic
1018896815 6:168025172-168025194 ATGAGTCTCTGTCCTTTGTTGGG - Intronic
1019946718 7:4335568-4335590 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1020532004 7:9350022-9350044 ATCACACTTTTTCCTTTGCTCGG - Intergenic
1022976285 7:35559330-35559352 ACTAGCCTGTTTGCTTTGTTTGG - Intergenic
1022991642 7:35714487-35714509 TTGACAGTGTTTCCTTTGCTGGG - Intergenic
1023162912 7:37314775-37314797 ATGATGATGTTTTCTTTGTTCGG - Intronic
1023756230 7:43419842-43419864 ATGACCTTGTCTCCTTTGTTCGG - Intronic
1024619780 7:51147427-51147449 ATGACCCTGTCTCCTTTGTTCGG - Intronic
1027457324 7:78409212-78409234 AGGACCCTGTGTCTTTTTTTAGG + Intronic
1027543979 7:79503265-79503287 ATGACCCTAACTCCTGTGTTAGG + Intergenic
1027947116 7:84761207-84761229 ATGTCCTTGTTTCCTTTGTTTGG + Intergenic
1029807372 7:103010885-103010907 ATGCCCATGTTTCTTTTGTTGGG - Intronic
1030207838 7:106967854-106967876 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1030852299 7:114504633-114504655 ATGACTCTTTTTCTTTTTTTGGG - Intronic
1031132672 7:117850608-117850630 ATAACCATGTTTCTCTTGTTTGG - Intronic
1031467034 7:122125473-122125495 ATGACCCTGTCTCTTTTGTTCGG - Intronic
1031885209 7:127239193-127239215 ATGTCTCAGTTTCCTTTTTTTGG - Intronic
1031935008 7:127727187-127727209 GTGTCCTTGTTGCCTTTGTTTGG + Intronic
1034584971 7:152082312-152082334 ATGACCCTGTCTCCTTTGTTCGG - Intronic
1035348746 7:158227828-158227850 ATGACCCTGTCTTCTCTGATTGG - Intronic
1035513865 8:214898-214920 GTAACTCTGTCTCCTTTGTTTGG + Intergenic
1035943444 8:3930635-3930657 GTGACCCTGTCTCCTTTGTTCGG + Intronic
1036802085 8:11800380-11800402 ATGACCCTGTCTCCTTTGTTTGG - Intronic
1037363826 8:18102080-18102102 ATAAACCTCTTTCCTTTATTTGG - Intergenic
1039004810 8:33022975-33022997 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1039699515 8:39947667-39947689 ATGACCCTGTCTCCTTTGTTTGG + Intronic
1039699814 8:39950618-39950640 ATAACTCTGTCTCCTTTGTTTGG - Intronic
1039926385 8:41936451-41936473 ATGAGCATTTTTACTTTGTTGGG - Intronic
1039961740 8:42253771-42253793 ATGACCCTGACTCCTTTGTTCGG - Intergenic
1040073864 8:43210357-43210379 ATCACTCTATTTCCTTTGCTGGG - Intergenic
1040848844 8:51877201-51877223 ATGACCCTGTCTCCTTTGTTCGG - Intronic
1041066568 8:54087884-54087906 ATGACTCTGTCTCCTTTGTTCGG - Intronic
1041392824 8:57362176-57362198 ATGACACTGTTAAATTTGTTAGG - Intergenic
1041745274 8:61201902-61201924 ATGACCCTGTCTCCTTTGTTTGG - Intronic
1041939131 8:63367481-63367503 ATGACTCTGTCTCCTTTGTTAGG - Intergenic
1042121369 8:65491914-65491936 ATGACCCTGCTTCCTGGCTTTGG - Intergenic
1046129830 8:109954011-109954033 ATACCCGTGTTTCCTTTGTTAGG + Intergenic
1046888225 8:119392583-119392605 ATTCTCCTCTTTCCTTTGTTAGG - Intergenic
1046923319 8:119758072-119758094 ATGACCCTGTACCCTATGTAAGG - Exonic
1047131138 8:122021122-122021144 ATTAACCTGTCTCCTGTGTTTGG - Intergenic
1047665972 8:127091471-127091493 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1047922420 8:129649094-129649116 ATGTCCACGTTTCATTTGTTGGG + Intergenic
1049461289 8:142729365-142729387 ATGAGCCTGTCTCCTTTGTTCGG - Intronic
1049461765 8:142733019-142733041 ATGACCCTGTTTCCTTTGTTGGG - Intronic
1050123880 9:2336362-2336384 AGTACCCAGTTTCCTTCGTTTGG - Intergenic
1051800616 9:20929325-20929347 CTAACCCTGTTTTCTTTCTTTGG + Intronic
1052250664 9:26393892-26393914 ATGCCCACATTTCCTTTGTTCGG + Intergenic
1052331289 9:27271620-27271642 GTACCCATGTTTCCTTTGTTAGG + Intergenic
1053062189 9:35040966-35040988 ATGACCCTGCCTCCTTTGTTCGG - Intergenic
1056031230 9:82555658-82555680 ATTTCCCAGTTTTCTTTGTTAGG - Intergenic
1056124845 9:83525809-83525831 TTGATCGTTTTTCCTTTGTTAGG - Intronic
1057366530 9:94427270-94427292 ATTTCACTGTTTCCTTTTTTGGG + Intronic
1057615118 9:96582575-96582597 ATGACCCTGTCTCCTTTGTTTGG + Intronic
1057646148 9:96877082-96877104 ATGACCGTATTTCCCTGGTTTGG - Intergenic
1057656805 9:96960794-96960816 ATTTCACTGTTTCCTTTTTTGGG - Intronic
1057977369 9:99620382-99620404 ATGAGACTGTTTCCCTTGGTAGG - Intergenic
1059200763 9:112413842-112413864 ATGACCCTGTCTGCTTTGATCGG - Intronic
1059422695 9:114202203-114202225 ATGCCTCTGCTTCCTTTGTGGGG + Intronic
1059818421 9:117944731-117944753 ATGACCCTATCTCCTTTGTTCGG - Intergenic
1061445140 9:130633362-130633384 CTAACCCTGTTTCCTTTCCTCGG + Intronic
1061562298 9:131413371-131413393 ATGACCCTGTCTCCTTTGTTCGG + Intronic
1186179371 X:6958088-6958110 ATGACCCTATCTCCTTTGTTCGG - Intergenic
1186244064 X:7601834-7601856 ATGTCCCTGTCTCCTTTGTTTGG + Intergenic
1186263344 X:7804962-7804984 TTTACCCTGTTTTCTTTTTTTGG + Intergenic
1187042072 X:15607306-15607328 ATAACCCTATCTCCTTTGTTCGG + Intergenic
1187385421 X:18844195-18844217 ATGACCCTGTCTCCTCTGTTCGG - Intergenic
1188157479 X:26757266-26757288 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1188207292 X:27376030-27376052 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1188688412 X:33098754-33098776 ATGACCCTGTCTCCTTTGTTCGG - Intronic
1188897833 X:35691756-35691778 ATAACTCTGTCTCCTTTGTTGGG - Intergenic
1189377816 X:40479473-40479495 ATTACCCTGTTACCTTTGATTGG - Intergenic
1189665484 X:43350647-43350669 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1189796595 X:44651612-44651634 ATTTCCCAGTTTCCTTTGCTTGG - Intergenic
1189825650 X:44914043-44914065 ATAACCCTGTCTCCTTTGTTTGG + Intronic
1192319426 X:70077566-70077588 ATGACCCTGTCTCTTTTGTTCGG - Intergenic
1192573976 X:72228182-72228204 ATGACCCTGTCTCCTTTGTTCGG + Intronic
1192718489 X:73668123-73668145 GTGACATTCTTTCCTTTGTTTGG + Intronic
1192849657 X:74941930-74941952 ATGCCCATGTTTCTTTTGTTGGG + Intergenic
1193718496 X:84959623-84959645 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1193812594 X:86069030-86069052 ATGACCTTGTCTCCTTTGTTTGG + Intergenic
1194063694 X:89236418-89236440 TTAACTTTGTTTCCTTTGTTAGG - Intergenic
1194369294 X:93051152-93051174 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1194709972 X:97224027-97224049 ATGATGCTGTTTAATTTGTTTGG + Intronic
1195155268 X:102116268-102116290 GTGCCCCTGTTTCCTCTGTTGGG - Intergenic
1196419660 X:115508632-115508654 AGGACTCTGTTCCCTTTTTTAGG - Intergenic
1196557482 X:117106351-117106373 GTGACCCTGATGCCTTTGTGAGG - Intergenic
1197360298 X:125493397-125493419 ATGACCCTGTCTCCTTTGTTCGG + Intergenic
1198867869 X:141144861-141144883 ATAACTCTGTCTCCTTTGTTTGG - Intergenic
1199151702 X:144494634-144494656 ATGACCCCGTCTCCTTTGTTCGG - Intergenic
1199221902 X:145326349-145326371 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1199234444 X:145474814-145474836 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1199637726 X:149829465-149829487 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
1199638248 X:149834042-149834064 ATGACCCTGTCTCCTTTGTTTGG + Intergenic
1200677486 Y:6167377-6167399 ATGACCCTGTCTCCTTTGTTCGG - Intergenic
1201298386 Y:12485370-12485392 AATACACTGTTTCCTCTGTTTGG - Intergenic
1201464638 Y:14267073-14267095 ATGACCCTGTCTGCTTTCTTCGG - Intergenic
1201539145 Y:15087342-15087364 AGGTTGCTGTTTCCTTTGTTCGG - Intergenic
1201569819 Y:15401758-15401780 CTGAGCCTGTTTCCTTTGAATGG + Intergenic
1201641412 Y:16181150-16181172 ATGACCCTGTCACCTTTGTTCGG + Intergenic
1201661403 Y:16404172-16404194 ATGACCCTGTCACCTTTGTTCGG - Intergenic
1202054527 Y:20815471-20815493 ATGCCTATGTTTCTTTTGTTGGG - Intergenic