ID: 1049462490

View in Genome Browser
Species Human (GRCh38)
Location 8:142736566-142736588
Sequence TGGTGACTCTGGGCCATTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049462490_1049462495 -10 Left 1049462490 8:142736566-142736588 CCTGGAATGGCCCAGAGTCACCA 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1049462495 8:142736579-142736601 AGAGTCACCAAGGCAAAGTTGGG 0: 1
1: 0
2: 3
3: 17
4: 165
1049462490_1049462499 8 Left 1049462490 8:142736566-142736588 CCTGGAATGGCCCAGAGTCACCA 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1049462499 8:142736597-142736619 TTGGGGCTGGTCCCAGCCTGAGG 0: 1
1: 0
2: 1
3: 33
4: 361
1049462490_1049462496 -9 Left 1049462490 8:142736566-142736588 CCTGGAATGGCCCAGAGTCACCA 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1049462496 8:142736580-142736602 GAGTCACCAAGGCAAAGTTGGGG 0: 1
1: 0
2: 2
3: 15
4: 143
1049462490_1049462497 -5 Left 1049462490 8:142736566-142736588 CCTGGAATGGCCCAGAGTCACCA 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1049462497 8:142736584-142736606 CACCAAGGCAAAGTTGGGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049462490 Original CRISPR TGGTGACTCTGGGCCATTCC AGG (reversed) Exonic
900506067 1:3030281-3030303 TGGTGACTCCAGGCCCCTCCTGG - Intergenic
900530063 1:3148719-3148741 TGGTGAATCTGGGCACTGCCTGG + Intronic
901271661 1:7956727-7956749 TGCTGACTGTGGTCCATTTCAGG + Intronic
902382911 1:16061012-16061034 TGGTGATGCTGAACCATTCCTGG - Intronic
903145465 1:21369254-21369276 TGGTGCCTCTTTACCATTCCTGG - Intergenic
903161298 1:21491040-21491062 TGGTGAGGCTGAGCCAGTCCTGG + Intergenic
904163628 1:28538701-28538723 TGGTGTCTCTTTGCGATTCCAGG - Intronic
906956361 1:50378243-50378265 TGGTGCCTCTGAGACTTTCCAGG - Intergenic
910183356 1:84509085-84509107 TGGTGACTCTGGGTCTTTTATGG - Intergenic
911144566 1:94540652-94540674 TGATGGCTCTGGGCTCTTCCCGG - Intronic
912109164 1:106318789-106318811 TAGTAACTCTGGGCCATTCAAGG + Intergenic
914928394 1:151908392-151908414 GGATGAATCTGGGCCATGCCGGG - Intronic
915912097 1:159921882-159921904 TGGGGACTGTGGCCCATTCTTGG - Intronic
916770745 1:167905095-167905117 TTCTGACTATGGGCCAGTCCTGG + Exonic
917510428 1:175664893-175664915 TGCTGTCTTTGGGCCATCCCTGG - Intronic
922209833 1:223478755-223478777 TGGTGACCTTGGGTCACTCCGGG - Intergenic
1063923321 10:10952547-10952569 TGGAGACTCTGGGACTTGCCAGG - Intergenic
1065320546 10:24505076-24505098 TGGTGACTCTAGAACATTCCAGG + Intronic
1067701670 10:48577651-48577673 TGGGGACTCTGGCCCTTTCTTGG - Intronic
1067746658 10:48941358-48941380 TGGTGACTGTGGACCCTTCTTGG + Intronic
1067893771 10:50158105-50158127 TGATGACACTGGGCCATTAAGGG + Intergenic
1067955074 10:50782163-50782185 TGATGACACTGGGCCATTAAGGG - Intronic
1069425410 10:68284551-68284573 GGGTGTGTCTGGGCCATTACAGG - Intronic
1075027701 10:118998518-118998540 TGGTGGCTCCGTGCCATCCCTGG - Intergenic
1076579008 10:131494486-131494508 TGGGCACACTGGGCCTTTCCTGG - Intergenic
1080187499 11:29507471-29507493 TAGTGTTGCTGGGCCATTCCAGG - Intergenic
1081802652 11:45870380-45870402 AATTGACTCTGGGGCATTCCAGG - Exonic
1081930645 11:46868538-46868560 TGCTGACTCTCAGCCCTTCCAGG + Intronic
1083340799 11:61957276-61957298 TGGTACCTATGGTCCATTCCTGG - Intronic
1083341583 11:61961869-61961891 GAGTGACTCTGGGCAATGCCAGG - Intronic
1083386426 11:62313653-62313675 TGGTTACTCTTGGCCTTCCCAGG - Intergenic
1083651576 11:64207576-64207598 GGGTGTCTCTGGGCACTTCCGGG + Intronic
1085511426 11:77090213-77090235 TGGTGACCCTGAGCCTCTCCTGG + Intronic
1085593995 11:77791355-77791377 TGGGGACTCTGGGCCAGTGCTGG + Intronic
1088696253 11:112368570-112368592 TGATGACTCAGGGCCCTCCCAGG - Intergenic
1094749202 12:33385961-33385983 TGGTGTGCCTGGGACATTCCTGG + Intronic
1095467584 12:42504214-42504236 TGGTGCCTCTGAGCCTTTTCTGG - Intronic
1095518107 12:43029417-43029439 TGGTGACAATGGGCCATCACTGG - Intergenic
1097666388 12:62482024-62482046 TGGTCACTCTAGGCCACTACTGG + Intronic
1098391507 12:69974072-69974094 TGGTTACCCTGGGCCATGGCTGG + Intergenic
1102021415 12:109686017-109686039 TGGTTTCTCTGGTCCAATCCTGG - Intergenic
1103386156 12:120534362-120534384 TGGCGACTCGTCGCCATTCCCGG + Exonic
1103586925 12:121963000-121963022 TGGAGACTCTGGTTCCTTCCCGG + Intronic
1104965194 12:132505783-132505805 TGGTCACTCCGGGGCTTTCCAGG - Intronic
1104970649 12:132529230-132529252 TGGCCACACTGGGTCATTCCTGG - Intronic
1109199939 13:59419127-59419149 TGGTGAAACTGGGGCAATCCTGG - Intergenic
1112051832 13:95650354-95650376 TGGGGACACCTGGCCATTCCTGG - Intergenic
1113092374 13:106629377-106629399 TGGGGGCTTTGGGGCATTCCTGG - Intergenic
1117428212 14:55623275-55623297 TTTTTACTCTGGGCCATTGCTGG - Intronic
1118873137 14:69760042-69760064 TGGAGATGCTGGGCCTTTCCTGG + Intronic
1119749318 14:77066357-77066379 TGGTGCCTCTGCACAATTCCAGG + Intergenic
1122159748 14:99774358-99774380 AGGTGACTCTGGGCCCTGCCAGG - Intronic
1122272298 14:100573702-100573724 TGGTGCCCCTTGGCCATCCCAGG + Intronic
1122757658 14:103995432-103995454 TTGTGCCCCTGGGCAATTCCAGG + Intronic
1124635250 15:31360992-31361014 TGGTAGCGCTGGGCCCTTCCAGG + Intronic
1129241647 15:74255684-74255706 TGGTCTCTCTGTCCCATTCCAGG - Intronic
1129323749 15:74788914-74788936 TGGGGACTCTGGGCCTCCCCAGG - Intronic
1129674939 15:77627422-77627444 AGGTGACTCCGGGGCATTGCAGG - Intronic
1130555349 15:84918626-84918648 TGGTGACTCTGGGAGAGCCCTGG - Intronic
1132405049 15:101536862-101536884 TGGTGACTCGCGGCCACACCCGG + Intergenic
1133297556 16:4762335-4762357 TGGTGACTCTGCTCCTTCCCAGG - Exonic
1135285329 16:21188183-21188205 TGGTCACTCTGGGGCAGACCTGG - Intergenic
1137607336 16:49795584-49795606 TGGTGCCCTTGGGCCCTTCCAGG - Intronic
1139062084 16:63264252-63264274 CCCTGGCTCTGGGCCATTCCTGG + Intergenic
1142142521 16:88478923-88478945 TGGTGGCTCCGGGCCACACCGGG + Intronic
1142885170 17:2908093-2908115 TGCTGACTCTGGGCCAGGCGTGG - Intronic
1143264283 17:5624176-5624198 GGGTGACCCTGGGCCCCTCCTGG + Intergenic
1144348164 17:14368555-14368577 TGTTTACTCTGGGCCATACAAGG + Intergenic
1144453338 17:15399227-15399249 TGTTGACTGTGAGCCATTCCAGG + Intergenic
1144765299 17:17729235-17729257 TGGTCACGCTGGGCCTTGCCTGG + Intronic
1147653929 17:42077890-42077912 TGGTGGCTCTGGGCTATTTTAGG - Intergenic
1147705088 17:42420857-42420879 TGGTGGCTCTCGGCCACACCAGG + Intronic
1147914304 17:43877518-43877540 AGGTGACTCTGACACATTCCTGG + Intronic
1148106059 17:45119626-45119648 TGGTGACCCTGGGCCAAGACAGG + Intronic
1152539628 17:80968442-80968464 TGGTGACCCTGGAGCATCCCGGG - Intergenic
1152899573 17:82932580-82932602 TGCTGACTCTCAGCCATTCAGGG + Intronic
1158972974 18:62685615-62685637 GGGTGATTCTGGGCAATTCATGG - Intergenic
1161064527 19:2231148-2231170 TGGTGGCTCTGTGCCCTCCCTGG + Exonic
1161134139 19:2609816-2609838 GGGTGCCTCTGGGCCATTGGGGG + Intronic
1161300386 19:3539617-3539639 TGGTGGCTCTGGGCAACCCCAGG + Intronic
1162809334 19:13154748-13154770 TGGTGAAACTGGGCCAATCTGGG + Exonic
1163237663 19:16038753-16038775 TGCTGTCCCTGGGCCAGTCCAGG + Intergenic
1163267163 19:16228243-16228265 TGGTGTCTCTGGCCCGTCCCAGG + Intronic
1164607745 19:29612289-29612311 TGGTGACTGGGGGCCATCTCAGG - Intronic
1165933341 19:39374346-39374368 TGGTGACTCAGGGTGATCCCAGG - Intronic
1166659606 19:44637749-44637771 TGATGACTCTGGGTCATCACTGG - Intergenic
925069072 2:951549-951571 TGGGGGCTCTAGGCCATTCGGGG + Intronic
926395818 2:12441067-12441089 TGGTGTCTCTGGGCCATCAAAGG - Intergenic
926530497 2:14039033-14039055 TGGTGAAGCTGGGTCAGTCCAGG - Intergenic
927423538 2:22956793-22956815 TGGCTACTCTGGGACATCCCAGG - Intergenic
932594650 2:73086521-73086543 CGGTGTCTCTGGGCCTTTTCTGG - Intronic
932966789 2:76485327-76485349 TGGTGGCCCTGGGCCACACCTGG + Intergenic
934725059 2:96611205-96611227 TGGTGGGTCTGGACCACTCCTGG - Intronic
934755442 2:96821135-96821157 TGGTGAGTGAGGGCCATTCGTGG + Intronic
935068682 2:99674841-99674863 TGGTGACTTTCAGCCATGCCAGG - Intronic
938816340 2:134908484-134908506 TGGTGACTCTAGGCCTTTCTTGG - Intergenic
940335814 2:152526175-152526197 TAGTTCCTGTGGGCCATTCCAGG + Intronic
942804003 2:179908628-179908650 TGGTGACTTCTGGCCATTCTTGG - Intergenic
948002627 2:234580640-234580662 TGGTCACTGTGGGCCATGCTTGG + Intergenic
949018021 2:241724528-241724550 TGGTGACTCTGAGCAAGTTCTGG - Intronic
1169570318 20:6898963-6898985 TGGAGACTCAGGGCTCTTCCTGG - Intergenic
1169995624 20:11553067-11553089 TGATGACTGTGGGCAATCCCTGG + Intergenic
1170900662 20:20459654-20459676 TGGTGTCCATGGCCCATTCCAGG - Intronic
1171465022 20:25321360-25321382 TGGAGCCTGGGGGCCATTCCTGG - Intronic
1174131871 20:48350746-48350768 TGGTGATTCTGGAGCATGCCAGG - Intergenic
1175091169 20:56505555-56505577 TGCTCACACTGGCCCATTCCTGG + Intronic
1175200495 20:57273694-57273716 TGGGGACTCTGGGCCCCTGCTGG - Intergenic
1176049765 20:63112571-63112593 TGGCCACTCTGGACCATGCCAGG + Intergenic
1176082274 20:63279694-63279716 AGGTCACTCAGGGCCATTTCTGG + Intronic
1176712682 21:10167757-10167779 TGATGAATCTGAGCCATTCAAGG - Intergenic
1177112865 21:17049510-17049532 TGGTGGGGCTGGGCCAGTCCAGG - Intergenic
1178405181 21:32317639-32317661 TGGCTACTCTGGGCCAGTCCTGG + Intronic
1178746409 21:35254975-35254997 TGATCACTTAGGGCCATTCCTGG - Intronic
1179321058 21:40291551-40291573 TGGTGTTTCTGGATCATTCCAGG + Intronic
1179979335 21:44888236-44888258 TGGTGGCCCTGGGCCCCTCCAGG + Intronic
1180866282 22:19121884-19121906 TGTTGCCTCTGGGCCCTTCCCGG - Intronic
1181547932 22:23614253-23614275 TGGTGACTCTGAGTCACTCGGGG + Intronic
1181909420 22:26226724-26226746 TGGTGTCACATGGCCATTCCTGG - Intronic
1182521093 22:30884859-30884881 TGCTGATTCAGGGGCATTCCTGG + Intronic
1182762591 22:32734690-32734712 TGCTGATTCTAGGACATTCCTGG + Intronic
1183466451 22:37982693-37982715 TGGTGACTCTGGGGCAGGGCAGG + Intronic
1184275778 22:43408888-43408910 TGGTGAGTGTGGGGCATTCAAGG - Intergenic
949416618 3:3821905-3821927 TGTTCACTCTGAGTCATTCCAGG - Intronic
950313065 3:11975811-11975833 TGGTCTGTCTGGGACATTCCTGG - Intergenic
950427858 3:12934376-12934398 TGGTGCTTTTGAGCCATTCCTGG - Intronic
951427776 3:22568012-22568034 TGGTGAATCTGCGGCCTTCCTGG - Intergenic
951566763 3:24019368-24019390 TGGTGAGGCTGGGCCATCCCAGG - Intergenic
952964844 3:38614761-38614783 TGGAGACCCAGGGCCATCCCTGG - Intronic
954214476 3:49116815-49116837 TGGAGAGACTGGGTCATTCCCGG + Exonic
954330455 3:49887238-49887260 AGCTGCCTCTGGGCCATGCCAGG - Exonic
956673014 3:71708943-71708965 TCCTGACTGTGGGCCATTTCTGG - Intronic
960408465 3:117291746-117291768 TGGTAACTCTGTGGCCTTCCTGG + Intergenic
961470441 3:127107923-127107945 TGGAGATCCTGGGCCATCCCTGG + Intergenic
963103407 3:141625602-141625624 GGGTGACTCAGGGCCCATCCTGG - Intergenic
967014929 3:185473267-185473289 TGGTGACTCTGGGACATGGCAGG - Exonic
968520606 4:1033182-1033204 TGGAGACCCTGGACCCTTCCAGG - Intergenic
968653924 4:1770620-1770642 GGGTGACTTGGGACCATTCCTGG + Intergenic
968759390 4:2434190-2434212 TGCTGCCGCTGGGCCTTTCCCGG - Intronic
976178911 4:82380990-82381012 TGGTGGGGCTGGGCCAGTCCAGG - Intergenic
977754856 4:100656662-100656684 TAGTGATTCTGGGCCATTGTAGG + Intronic
978089587 4:104698590-104698612 AGGGGACTCTTGGCCAGTCCTGG - Intergenic
984819743 4:183871097-183871119 TGGTGAGTGGGTGCCATTCCTGG + Intronic
985481154 5:111602-111624 TGCCGACACTGGGCCATCCCCGG - Intergenic
985481164 5:111652-111674 TGCCGACACTGGGCCATCCCCGG - Intergenic
987737956 5:21869310-21869332 GGAAGACTCTGGGTCATTCCTGG - Intronic
990123492 5:52485286-52485308 TGGAGACACTGGGCAATTTCTGG - Intergenic
990499740 5:56384116-56384138 TGGAGAGTCTGAGCCAATCCAGG - Intergenic
990804662 5:59645447-59645469 GGGTGACTGTGGGCCATTTTGGG + Intronic
997401959 5:133610872-133610894 TTGTGACACAGGCCCATTCCCGG + Intronic
999754350 5:154653433-154653455 TGGCGCCTCTGGGCCCTGCCTGG - Intergenic
1001239557 5:170057665-170057687 AGGTGAGTCTGGGACATTCGTGG + Exonic
1001976953 5:176007847-176007869 TGGTGATTCTGGGAAATCCCTGG - Intronic
1002240475 5:177835933-177835955 TGGTGATTCTGGGAAATCCCTGG + Intergenic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1003231008 6:4253837-4253859 TGCTGTTTCTGGGCCACTCCCGG - Intergenic
1004916196 6:20334414-20334436 TAGTGGCTCCTGGCCATTCCAGG + Intergenic
1005018090 6:21392712-21392734 TTGTGAATCTGGCCCAGTCCAGG - Intergenic
1005887180 6:30106071-30106093 TGGGGACAATGGCCCATTCCTGG + Intronic
1007271184 6:40638415-40638437 TGGAGACCCTGAGCCATTCTGGG + Intergenic
1011726195 6:90212846-90212868 TTGTCACTCTTGGCCCTTCCTGG - Intronic
1015803948 6:137089952-137089974 AGGTGACTCTAGGCCAGGCCAGG + Intergenic
1015922749 6:138281900-138281922 TGGGGACTCAGAGCCAATCCAGG - Intronic
1016173835 6:141053424-141053446 TATAGACTGTGGGCCATTCCAGG - Intergenic
1016417029 6:143843609-143843631 TGGTGACGTTGGCCCATTTCGGG - Intronic
1017635795 6:156441804-156441826 TGGTACCTCTGAGACATTCCAGG + Intergenic
1018503544 6:164439707-164439729 GGGTGGCTCTGGGCAATTCCTGG + Intergenic
1020518883 7:9161201-9161223 TGGTTATTCTGGGCCTTTCGTGG + Intergenic
1021831701 7:24618713-24618735 TTCTGACTCTGGGCCATTCCAGG + Intronic
1022977938 7:35575739-35575761 TGGTGTCACTGGGCCTTTCTAGG - Intergenic
1024337694 7:48225971-48225993 TCGTGCCCCTGGTCCATTCCTGG - Intronic
1026524314 7:71141076-71141098 TGGTGACTCAGGGCCAGGCGTGG + Intronic
1029237363 7:99132096-99132118 TTGGGCTTCTGGGCCATTCCAGG - Intronic
1030384882 7:108856681-108856703 AGGTGTCTCTGTGCTATTCCAGG - Intergenic
1033676580 7:143546035-143546057 AGATGACTCTGGGTCATTACTGG + Intergenic
1033695253 7:143783403-143783425 AGATGACTCTGGGTCATTACTGG - Intergenic
1035640946 8:1184780-1184802 TGGTGAATCTGGCCCTCTCCAGG + Intergenic
1036752537 8:11452437-11452459 TGGTGCCTCTGGGCTGTTTCAGG + Intronic
1036958780 8:13220869-13220891 GGGTGACTGTGGGCCCTGCCAGG + Intronic
1037520743 8:19678529-19678551 TGGGGACACAGGGACATTCCTGG - Intronic
1037859174 8:22392671-22392693 TGGCCACTGTGGGCCCTTCCCGG + Intronic
1038401643 8:27288516-27288538 TGGTGTCTCCTGGCCATTCTTGG - Intronic
1039587453 8:38719115-38719137 TGCTGACCCTGTGCCATCCCCGG - Intergenic
1040885555 8:52259424-52259446 TGTAGACTCTGGGTAATTCCTGG + Intronic
1044469304 8:92547693-92547715 TGGGGAGGCTGGGCCAATCCTGG - Intergenic
1044828630 8:96223460-96223482 TGTTCACTGTGGGCCATTTCAGG - Intergenic
1047541914 8:125776041-125776063 TTGTTACTCTGGGCCTTTCCAGG - Intergenic
1048106648 8:131418334-131418356 TAGTGACTCTGGACCCTTCTTGG + Intergenic
1049287066 8:141781612-141781634 TGGAAACTCTGGGCCATCCCTGG - Intergenic
1049462490 8:142736566-142736588 TGGTGACTCTGGGCCATTCCAGG - Exonic
1049548090 8:143243936-143243958 TGGTGACAATGGGAGATTCCGGG + Intergenic
1050475642 9:6037999-6038021 TGGTGAAACTGGGCCAATCTGGG - Intergenic
1051910989 9:22154310-22154332 TGGTGACACTGGGGCCCTCCAGG - Intergenic
1052784104 9:32812718-32812740 TGAGTCCTCTGGGCCATTCCAGG - Intergenic
1053270359 9:36745388-36745410 TGGTGACTCCTGGGCATCCCAGG + Intergenic
1053448593 9:38173047-38173069 TGGGGGCTTTGGGCCATTCTTGG - Intergenic
1053539341 9:38957787-38957809 TGGTGTCTCAGGTCAATTCCTGG + Intergenic
1053756062 9:41310390-41310412 TGATGAATCTGAGCCATTCAAGG + Intergenic
1054330200 9:63745320-63745342 TGATGAATCTGAGCCATTCAAGG - Intergenic
1054626798 9:67406131-67406153 TGGTGTCTCAGGTCAATTCCTGG - Intergenic
1055004976 9:71496136-71496158 TCCTGACTCTGAGCCAATCCAGG - Intergenic
1056113901 9:83423386-83423408 TGGTAACCCTGGGCCATGCAAGG + Intronic
1056575220 9:87851332-87851354 TGGGGACGCTGGGCTATCCCTGG - Intergenic
1057211811 9:93204612-93204634 TGCTGACTCTGAGCCATCACGGG + Intronic
1058678615 9:107422501-107422523 TGGTGAGGCTGGCCCCTTCCAGG - Intergenic
1058870695 9:109199145-109199167 TGGTGATTCTGGGACATTTTGGG + Intronic
1059990619 9:119861962-119861984 TGTGGACTCTGGGGCAGTCCTGG + Intergenic
1061720426 9:132547723-132547745 TGGTGTCTCTGGACCATTTCAGG - Intronic
1062545878 9:137063601-137063623 TGGTGACACTGGGACCCTCCAGG + Exonic
1202797429 9_KI270719v1_random:136747-136769 TGATGAATCTGAGCCATTCAAGG - Intergenic
1186518658 X:10186355-10186377 TGGTAACTCTGGGCACTGCCTGG - Intronic
1190928207 X:54927267-54927289 TGTTGAGTCTGGCCCAGTCCTGG - Intronic
1191640312 X:63424439-63424461 TTGTGACTCTGGGTGACTCCAGG + Intergenic
1192217849 X:69176526-69176548 TGGAAACTGAGGGCCATTCCTGG + Intergenic
1197524128 X:127540526-127540548 TGGTGATTCTGGGTCTTTCATGG + Intergenic
1199535317 X:148896033-148896055 TGGGGATTCTGGGACATGCCTGG - Intronic