ID: 1049462494

View in Genome Browser
Species Human (GRCh38)
Location 8:142736578-142736600
Sequence CAGAGTCACCAAGGCAAAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049462486_1049462494 12 Left 1049462486 8:142736543-142736565 CCTTACAGCTGGGGAAACTGAGG 0: 1
1: 10
2: 84
3: 292
4: 1095
Right 1049462494 8:142736578-142736600 CAGAGTCACCAAGGCAAAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 196
1049462485_1049462494 17 Left 1049462485 8:142736538-142736560 CCTCACCTTACAGCTGGGGAAAC 0: 1
1: 3
2: 93
3: 588
4: 2633
Right 1049462494 8:142736578-142736600 CAGAGTCACCAAGGCAAAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 196
1049462480_1049462494 28 Left 1049462480 8:142736527-142736549 CCTGCCTAATGCCTCACCTTACA 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1049462494 8:142736578-142736600 CAGAGTCACCAAGGCAAAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 196
1049462481_1049462494 24 Left 1049462481 8:142736531-142736553 CCTAATGCCTCACCTTACAGCTG 0: 1
1: 0
2: 3
3: 14
4: 172
Right 1049462494 8:142736578-142736600 CAGAGTCACCAAGGCAAAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049462494 Original CRISPR CAGAGTCACCAAGGCAAAGT TGG Exonic
904170698 1:28590540-28590562 CTGAGTCTCCAAGGATAAGTGGG - Intronic
906937576 1:50227375-50227397 AAGAGTAACCAAGAGAAAGTGGG - Intergenic
907155467 1:52329940-52329962 CAAAGACAGCAAGGCAAAGTGGG + Intronic
907824585 1:58003196-58003218 CCCAGTCACCAGGGCATAGTAGG + Intronic
908651119 1:66334234-66334256 TAGAGTCACCAAGATAAAGCAGG + Intronic
909872497 1:80760227-80760249 CAAATTCAACAAGGAAAAGTGGG - Intergenic
910680518 1:89859378-89859400 CAAAGGCACCAAGGCAACATAGG - Intronic
910772468 1:90843996-90844018 CAGAACTACCAAGGCAAAGTAGG - Intergenic
911579669 1:99620237-99620259 TAGAGTCAGCAAGTCAAAGCAGG + Intergenic
915550003 1:156626250-156626272 CAGGGCCACCAAGGCAAATGGGG + Intergenic
917586697 1:176434301-176434323 CATAGCCAACATGGCAAAGTAGG - Intergenic
917675008 1:177310524-177310546 CAGAGTCACCCAGCTATAGTTGG - Intergenic
920264086 1:204708988-204709010 CAAATTCCCCAAGGCAAAGATGG - Intergenic
921760173 1:218904261-218904283 CAGAGAAATCAATGCAAAGTTGG - Intergenic
922999434 1:229994586-229994608 CAGAGTTAGCAAGTCAAAGGAGG + Intergenic
924331275 1:242943144-242943166 TAGAGTTACCCAGGCACAGTGGG - Intergenic
924816306 1:247445016-247445038 TAGAATCACCAAGGCTAAGCTGG + Intronic
1066545281 10:36492984-36493006 CAGAGCATCCAAGTCAAAGTGGG + Intergenic
1066716773 10:38295235-38295257 CAGAGGCCCTAAGGCAAACTCGG + Intergenic
1067004960 10:42651868-42651890 CAGAGGAACCAAGGCGCAGTAGG + Intergenic
1067511608 10:46899430-46899452 CAGAGAAAGCAGGGCAAAGTTGG + Intergenic
1067650638 10:48152409-48152431 CAGAGAAAGCAGGGCAAAGTTGG - Intergenic
1068750331 10:60584888-60584910 CAAGGTCACCAAGGCCCAGTGGG + Intronic
1070750572 10:78961813-78961835 CAGGGACACCAAGGCACAGTGGG + Intergenic
1072761980 10:98064096-98064118 TAGAGTCCTCAAGCCAAAGTTGG + Intergenic
1073108251 10:101045571-101045593 CCAAGGCACCAAGGCACAGTGGG + Intergenic
1073119924 10:101115330-101115352 CAGAGTAACTTAGGAAAAGTTGG - Intronic
1073462615 10:103675149-103675171 CAGAGCCTCCAAGGCAGAGCTGG + Intronic
1074313450 10:112342155-112342177 CAAAGTAACCATGGCAAACTAGG - Intergenic
1078641623 11:13102108-13102130 CAGAGTCAGAAAGGAAAAGAAGG - Intergenic
1079288345 11:19161394-19161416 CACAGTCCCCATGGCAAAATTGG + Intronic
1079369491 11:19838469-19838491 GAGGGCCAGCAAGGCAAAGTCGG + Intronic
1079664747 11:23090827-23090849 AATAGTTACAAAGGCAAAGTGGG - Intergenic
1084289188 11:68150988-68151010 CAGAATCACCCTGGCAAAGGTGG + Intergenic
1088071989 11:105798412-105798434 GAGAGTGACAAAGCCAAAGTGGG + Intronic
1088847745 11:113682119-113682141 CAGAGTGACCAGGGGAAACTGGG + Intergenic
1089783876 11:120894364-120894386 CAGAACCAGCAACGCAAAGTTGG - Intronic
1090900274 11:131024806-131024828 CAGAGTCTCCTAGGCAAAAATGG + Intergenic
1092725454 12:11481148-11481170 CATACTCTCCAAAGCAAAGTAGG - Intronic
1098085819 12:66841858-66841880 CACATTTACAAAGGCAAAGTAGG + Intergenic
1098624827 12:72651627-72651649 AAAAATCACTAAGGCAAAGTAGG + Intronic
1100284779 12:93154873-93154895 CTGAGTCACGAAGGCAATGAAGG - Intergenic
1100635326 12:96430040-96430062 CAGAGTGAAAAAGGCAAAGTTGG - Intergenic
1101103657 12:101419693-101419715 CAGAATAGCCAAGACAAAGTAGG - Intergenic
1101195012 12:102372784-102372806 CAGATTCAAGAAGGCAAAGCAGG + Intergenic
1102574142 12:113845215-113845237 CAGAGTCACCAGGGCAGTGAAGG - Intronic
1102655806 12:114481342-114481364 CAGAGGGAGGAAGGCAAAGTGGG + Intergenic
1103334412 12:120178525-120178547 TAGGGTCACCAGGGCAAAGCAGG + Intronic
1106551403 13:30774353-30774375 CAGAAACACCACAGCAAAGTAGG + Intergenic
1108156806 13:47593459-47593481 CAGAATTACCATGGCAATGTAGG + Intergenic
1108638671 13:52361511-52361533 AAGAGTCACTAAGGCAGAGCAGG - Intergenic
1108644742 13:52415877-52415899 CTGAGTCATCACGGCAAAGATGG + Exonic
1109273795 13:60282350-60282372 CACAGTCCCAAAGGAAAAGTGGG + Intergenic
1111552574 13:89833948-89833970 CAAAGCCACCCAGGCAAAGCAGG - Intergenic
1112556013 13:100469283-100469305 CAGAGCTACCCAGGCAAAGCAGG + Intronic
1116229057 14:42192759-42192781 CATAGGCACAAAGGCAAAATAGG - Intergenic
1118001566 14:61527891-61527913 CAGAGTCTCCCAGGCAGAGAAGG - Intronic
1118851460 14:69587058-69587080 GGGAGTCAGCCAGGCAAAGTGGG + Intergenic
1122407489 14:101509019-101509041 CAGAGTGACCCAGGCCAAGGTGG - Intergenic
1122639349 14:103148758-103148780 AAGTGTCACCATGGCAAAGCTGG + Intergenic
1122653625 14:103241653-103241675 AAGTGTCACCATGGCAAAGCTGG + Intergenic
1124585138 15:30998159-30998181 CAGAGTCACTAAGGCCAGCTCGG - Intergenic
1126225306 15:46262600-46262622 CAGAGTGTCCAAGGCAACCTTGG - Intergenic
1127588527 15:60399613-60399635 TAGAGTGACACAGGCAAAGTCGG + Intronic
1127737103 15:61851993-61852015 AAGAGTCTTCAAGCCAAAGTCGG + Intergenic
1127991669 15:64123323-64123345 CAGAGGCCCTGAGGCAAAGTAGG + Intronic
1128053996 15:64686269-64686291 TAGAGTCACAAAGGCTAAATTGG - Intergenic
1128764826 15:70244630-70244652 CAGAGTGACCAACCCAAAGGGGG - Intergenic
1129123187 15:73415751-73415773 GATGGTCAACAAGGCAAAGTGGG - Intergenic
1129959315 15:79668974-79668996 CAAAGCCACCCAGGCAAAGGAGG - Intergenic
1130383592 15:83392658-83392680 CAGAGTCACCAGGTCAAGGCAGG + Intergenic
1131011119 15:89019280-89019302 CAGGGTCAACAATGCAAAGCAGG + Intergenic
1132047185 15:98574053-98574075 CAGAACCACCAAGCAAAAGTAGG - Intergenic
1132999276 16:2840995-2841017 CACAGCCACCAAGGCCGAGTGGG + Intergenic
1134035456 16:11027101-11027123 CAAAGCCACCCAGGCAAAGCAGG + Intronic
1135994853 16:27240242-27240264 CAGAGTCACCAAGAGAGACTGGG + Intronic
1136480404 16:30538133-30538155 CAAAGCCACCCAGGCAAAGCAGG - Intronic
1138833746 16:60408277-60408299 CTGAGTGACCAAGACAAAGGGGG + Intergenic
1139574556 16:67832815-67832837 CAGAATCACAAAGGATAAGTAGG + Intronic
1139747882 16:69089024-69089046 CAGAGCCACCGAGGCCAAGTTGG - Intergenic
1142590877 17:1005413-1005435 CACAGGCAGCAAGGCAAAGCAGG + Exonic
1142673717 17:1500234-1500256 GAGAGTCACCAAGGTGGAGTGGG - Intronic
1143340345 17:6206251-6206273 CAGACTCCCAAAGGCAAAGCAGG - Intergenic
1143691696 17:8572677-8572699 CAGAGTCACCATGGTAATGGTGG + Intronic
1143804241 17:9413246-9413268 CAGACTGACCAGGGCTAAGTGGG + Intronic
1144166217 17:12613457-12613479 TAGAGTCAAAAAGGCAAAGTTGG - Intergenic
1146735080 17:35232043-35232065 GGGAGTCCCCAAGTCAAAGTTGG + Intergenic
1147806191 17:43133566-43133588 CAGACTGAGCAAGGCAGAGTTGG - Intergenic
1147997037 17:44365662-44365684 CAAAGCCACCCAGGCAAAGCAGG - Intergenic
1148167525 17:45493648-45493670 AAGACTGAGCAAGGCAAAGTTGG + Intergenic
1150398706 17:64840061-64840083 AAGACTGAGCAAGGCAAAGTTGG + Intergenic
1151100966 17:71554873-71554895 CATTGTCACCAATGCAAATTGGG + Intergenic
1151667841 17:75555854-75555876 CAGAGTCACAAAGGGACAGGGGG + Intronic
1152016938 17:77756980-77757002 CAGAGGCAGCAAGGCAGGGTGGG - Intergenic
1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG + Intronic
1152107187 17:78337507-78337529 GTGAGTCACCATGGGAAAGTTGG + Intergenic
1152499018 17:80695794-80695816 CAGAGGCACCAAGGCCAGGGAGG + Intronic
1153542903 18:6175207-6175229 CAGAGCCACGATGGGAAAGTGGG + Intronic
1156315162 18:35962818-35962840 CAGAGGCACCAAGGCAACAGGGG + Intergenic
1157827939 18:50829793-50829815 CAGGGTAACCAAGGCAAATCTGG - Intergenic
1159741907 18:72181781-72181803 GAGAGTGAGTAAGGCAAAGTAGG - Intergenic
1162145894 19:8611799-8611821 CAGAGTGACCAAGACCAAGAGGG - Intergenic
1162322817 19:9979873-9979895 CAGGGTCACCAAGGTAAAGATGG - Exonic
1165814956 19:38636223-38636245 CTGAGTCAACAAGGAAAAGGAGG + Intronic
1168088178 19:54063735-54063757 GAGACTCACCGAGGCAAAGCAGG + Exonic
1168700746 19:58437985-58438007 CTGAGTCCCCAAGCCAAGGTGGG - Intronic
927147576 2:20176926-20176948 CAGAGTCGTCAAGGCCAAGAGGG - Intergenic
927554750 2:24023751-24023773 CAGAGGCACCAAGGACCAGTGGG + Intronic
928106218 2:28472068-28472090 CAGAGGCACCAAGTGCAAGTGGG - Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
932171042 2:69556686-69556708 GAGAGTGACCAAGGCAAGGGCGG + Intronic
934700362 2:96434770-96434792 CAAAGGCAACAAGGAAAAGTGGG - Intergenic
936249100 2:110853677-110853699 CAGAGACACAAATGCACAGTAGG + Intronic
937972921 2:127564359-127564381 CAGGGGCTCCAAGGCCAAGTGGG + Intronic
944129411 2:196330812-196330834 CAGATACAACAAGGGAAAGTGGG - Intronic
944876603 2:203968845-203968867 CAGTGCCACCTGGGCAAAGTGGG - Intergenic
946150316 2:217761192-217761214 CAAAGCCACCCAGGCAAAGCAGG - Intergenic
946858085 2:223973082-223973104 CACAGTGACCAAGGCAGAATCGG + Intergenic
947829592 2:233129600-233129622 CAGATTCCACACGGCAAAGTCGG + Intronic
1170304361 20:14921526-14921548 CAAAGACGCCAAGGCAAAGAAGG - Intronic
1172993803 20:39055144-39055166 CAGAGTGCCCAAGGCTTAGTGGG + Intergenic
1180230154 21:46422223-46422245 CAGAGGCACCCAGGAAAAGCTGG - Intronic
1181081841 22:20420776-20420798 CAGAAACACCAAGACACAGTGGG - Intergenic
1181886954 22:26029058-26029080 CAGAATCACCAGGGCATAATTGG + Intronic
1184238813 22:43200825-43200847 CAGTGTGCCCAGGGCAAAGTTGG - Exonic
956445729 3:69323967-69323989 CAGACTCACCAAACCAGAGTTGG + Intronic
959126573 3:102296925-102296947 CAGATTTAGAAAGGCAAAGTAGG - Intronic
959302375 3:104619349-104619371 GAGAGTCACCAGGGCAGTGTAGG - Intergenic
960434478 3:117608970-117608992 CAGAGTCACGAAGCCCAAATTGG + Intergenic
962331994 3:134486304-134486326 CAGAATCACCAAGGCAGCCTGGG - Intronic
962824007 3:139082275-139082297 CAAAGCCATCCAGGCAAAGTAGG - Intronic
965612207 3:170556335-170556357 CAGAGGCAATATGGCAAAGTGGG + Intronic
966548439 3:181178322-181178344 CAGAGGCATCAATGTAAAGTTGG - Intergenic
966678059 3:182610751-182610773 CAAAGCCACCCAGGCAAAGCAGG + Intergenic
968377023 4:52231-52253 GAGAGTGAGCAAGGCAGAGTAGG - Intergenic
969886968 4:10223472-10223494 CAGACCCACCAAGACAAGGTTGG - Intergenic
972387895 4:38585550-38585572 CAGTGTGACCAAGGCACAGTGGG - Intergenic
972889998 4:43546120-43546142 CAGCTTCACCAATGCCAAGTTGG + Intergenic
975638217 4:76471864-76471886 CAGAGTTACCTAGGAAGAGTTGG + Intronic
975702835 4:77083035-77083057 CAAAGCCACCCAGGCAAAGCAGG - Intergenic
977648542 4:99442369-99442391 CATATTCACCACGGAAAAGTAGG + Intergenic
977698274 4:99991378-99991400 CAAAGCCACCCAGGCAAAGCAGG - Intergenic
977855554 4:101886327-101886349 CAGAAACAGCAAGGCAAAGAAGG + Intronic
978598100 4:110400412-110400434 CAAAGCCACCCAGGCAAAGCAGG - Intronic
978976138 4:114876224-114876246 CAGAGCCACAAAGGCAAAAATGG - Intronic
980196396 4:129594158-129594180 CAGAGTCAACAAACCAAAATTGG + Intergenic
980691901 4:136305981-136306003 CAGAGTGACACAGGCCAAGTGGG - Intergenic
981634375 4:146859328-146859350 CAAAGAAACCAAGGCAAAGGAGG - Intronic
982289362 4:153764334-153764356 CAGAGGGACCAAGGAAAACTGGG - Intergenic
984752840 4:183295528-183295550 CAGCGTCACCAAGGCACAGCTGG - Intronic
986179717 5:5382410-5382432 CAAAGTCACAAAGGGAAAGCAGG + Intergenic
986808044 5:11327277-11327299 CAGATCCCCAAAGGCAAAGTGGG + Intronic
990404048 5:55469901-55469923 CAGAGTGACCTAAACAAAGTAGG + Intronic
990484623 5:56245881-56245903 CAGAGTCTCTAATGCAGAGTAGG - Intergenic
990986820 5:61648467-61648489 CAGAGTGAACAAAGGAAAGTAGG + Intronic
993065833 5:83096100-83096122 CTGAGTCACCAAGGCAGGCTTGG - Intronic
993744672 5:91582765-91582787 CAGGGTCACCAAGGCCAACTGGG - Intergenic
994863449 5:105230638-105230660 CAGAGACACAAAGCCACAGTTGG + Intergenic
995107612 5:108392730-108392752 CAGAGTCATGAAAGAAAAGTAGG + Intergenic
1001021024 5:168182735-168182757 CAGAGTCAGCAATGCTAACTGGG + Intronic
1002940638 6:1712631-1712653 CAGAGACATCAAAGTAAAGTGGG - Intronic
1004346135 6:14850852-14850874 CAGCGACACCAAGGGAAAGTGGG - Intergenic
1004727324 6:18323807-18323829 CAGAACCACCAAGGCACAGCTGG - Intergenic
1005511270 6:26513522-26513544 CTGAGTTACCCAGGCAAAGTAGG + Intergenic
1006170610 6:32089839-32089861 CAGAGTTGCCAGGGCAAAGCTGG - Intronic
1006729458 6:36225351-36225373 CAGACTCACCAAGGCAGGGTAGG - Exonic
1007569736 6:42880924-42880946 CAAAGCCACCCAGGCAAAGCAGG + Exonic
1008172292 6:48223339-48223361 CACAGTCACTAAGGCAAACAAGG - Intergenic
1008535957 6:52506250-52506272 CAGAGCCAGCCAGGGAAAGTGGG - Intronic
1010020463 6:71154045-71154067 CAGAGTCCCCATGGCAGAATTGG - Intergenic
1014008649 6:116450931-116450953 CAGAGTCACCAAGCCACAGCGGG - Intergenic
1014045787 6:116884457-116884479 CAGATTCAAAAAGGCAAAATGGG + Intronic
1014287718 6:119520020-119520042 CAGCTTCACCAGGGCAAAGTTGG + Intergenic
1016784237 6:147992489-147992511 GAGAGTCACCAAGGTTAATTGGG - Intergenic
1018498085 6:164370727-164370749 CAGACTCCCCAAGGAAAATTGGG + Intergenic
1027178782 7:75922830-75922852 CAAAGCCACCCAGTCAAAGTAGG + Intronic
1027798515 7:82723107-82723129 CAAAGGCAGCAAGGCAGAGTGGG - Intergenic
1028671676 7:93407732-93407754 CAGAGTGGCAAAGGCAGAGTGGG + Intergenic
1028913840 7:96237277-96237299 CATTGTCACCAAACCAAAGTCGG - Intronic
1029278832 7:99424057-99424079 CAGGGCCAGCAAGGCAAACTTGG + Intronic
1029731169 7:102439168-102439190 CACACTCACCATGGCAAAGCCGG - Exonic
1029853206 7:103486330-103486352 AAGAGTCACCGAGGCAAACTGGG - Exonic
1031087818 7:117321068-117321090 CAGGGGCACAGAGGCAAAGTCGG + Intronic
1031211799 7:118838475-118838497 CAGAGTCAGCAATGCAAGGTTGG - Intergenic
1032723987 7:134574457-134574479 CAGAGTCAGAAAGGCAGAGAAGG - Intronic
1034571330 7:151958804-151958826 GAGAGTCAGCAAGGCAGAGAAGG + Intronic
1035581972 8:746155-746177 CAGAGAGACCAGGCCAAAGTGGG + Intergenic
1037622548 8:20577455-20577477 CAGAGTCACCCAGGCAAAACTGG + Intergenic
1039719890 8:40151884-40151906 CAGAGTGAGCAGGGCAGAGTGGG - Intergenic
1040019326 8:42726129-42726151 CAAAGCCACCCAGGCAAAGCAGG - Intronic
1041337244 8:56800254-56800276 CAGAGTCAGCCAGGCAGAGAGGG + Intergenic
1041429241 8:57760264-57760286 CAGAGACCCCAAGGCAAATGTGG + Intergenic
1042098016 8:65240257-65240279 CTGACTCCCCCAGGCAAAGTTGG + Intergenic
1042396671 8:68299520-68299542 CAGAATTACCAAAGCAAAATAGG + Intergenic
1043945004 8:86239754-86239776 CAGAGTCATATAGGCACAGTGGG - Intronic
1044240384 8:89881438-89881460 CATGGTCACCAGGGAAAAGTTGG + Intergenic
1048929049 8:139296386-139296408 CACAGTCTCCAAGGATAAGTTGG + Intergenic
1049462494 8:142736578-142736600 CAGAGTCACCAAGGCAAAGTTGG + Exonic
1050185105 9:2965116-2965138 TAGAGACAGCAAGGCAAAGACGG + Intergenic
1051613356 9:18982541-18982563 CAGAGTCACCATGGCAGAAGGGG + Intronic
1052971918 9:34381720-34381742 CAGAGTCAGCTAGACAAAGAGGG - Intronic
1054833563 9:69652354-69652376 CAGAGTGAGCAGGGCAAAATAGG + Intronic
1054987661 9:71281143-71281165 CAGAACCACAAAAGCAAAGTCGG + Intronic
1057002317 9:91522551-91522573 CAGAGACAGAAATGCAAAGTGGG + Intergenic
1057772312 9:97979759-97979781 CAGACTCAGCAAAGCCAAGTAGG - Intergenic
1060730701 9:126035018-126035040 CAGAGCCACCAATGCCAAGGGGG + Intergenic
1060937434 9:127523829-127523851 CACAGGGACCACGGCAAAGTCGG - Exonic
1061154084 9:128846675-128846697 CAGGGTCACCCAGCCAAGGTGGG - Intronic
1062105967 9:134755018-134755040 CTGAGTCAACAAGGCAAAAATGG + Intronic
1062444123 9:136586273-136586295 AACACTCACCCAGGCAAAGTGGG + Intergenic
1203572214 Un_KI270744v1:142015-142037 GAGAGTGAGCAAGGCAGAGTAGG + Intergenic
1190140763 X:47841602-47841624 CAAAGCCACCCAGGCAAAGCAGG - Intronic
1197482235 X:127001762-127001784 CAGATTCACCAAGGAATAGGGGG - Intergenic
1199497101 X:148464767-148464789 CAAAGCCACCCAGGCAAAGCAGG + Intergenic
1199739027 X:150715150-150715172 CAGGGTCACCAAAGGAGAGTGGG - Intronic
1201228618 Y:11842279-11842301 TAGAGTTACCCAGGCACAGTGGG - Intergenic