ID: 1049462530

View in Genome Browser
Species Human (GRCh38)
Location 8:142736735-142736757
Sequence GGAGGCAGTTCTGGATGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049462530_1049462539 20 Left 1049462530 8:142736735-142736757 CCTGCACATCCAGAACTGCCTCC 0: 1
1: 0
2: 1
3: 28
4: 285
Right 1049462539 8:142736778-142736800 CCCACCTTGAGCCAGAGTCAAGG 0: 1
1: 0
2: 2
3: 21
4: 169
1049462530_1049462541 21 Left 1049462530 8:142736735-142736757 CCTGCACATCCAGAACTGCCTCC 0: 1
1: 0
2: 1
3: 28
4: 285
Right 1049462541 8:142736779-142736801 CCACCTTGAGCCAGAGTCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 120
1049462530_1049462532 -6 Left 1049462530 8:142736735-142736757 CCTGCACATCCAGAACTGCCTCC 0: 1
1: 0
2: 1
3: 28
4: 285
Right 1049462532 8:142736752-142736774 GCCTCCTTGCCGCTGCCTCCAGG 0: 1
1: 1
2: 2
3: 38
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049462530 Original CRISPR GGAGGCAGTTCTGGATGTGC AGG (reversed) Exonic