ID: 1049463559

View in Genome Browser
Species Human (GRCh38)
Location 8:142740974-142740996
Sequence CGTGGGGTATGGAAGGCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049463550_1049463559 28 Left 1049463550 8:142740923-142740945 CCAGGAAGGACAAAAGTCATGTC 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1049463559 8:142740974-142740996 CGTGGGGTATGGAAGGCAGAGGG 0: 1
1: 0
2: 2
3: 14
4: 258
1049463552_1049463559 6 Left 1049463552 8:142740945-142740967 CCACTCTTGGCTTAGTTATGTTT 0: 1
1: 1
2: 0
3: 31
4: 539
Right 1049463559 8:142740974-142740996 CGTGGGGTATGGAAGGCAGAGGG 0: 1
1: 0
2: 2
3: 14
4: 258
1049463549_1049463559 29 Left 1049463549 8:142740922-142740944 CCCAGGAAGGACAAAAGTCATGT 0: 1
1: 0
2: 0
3: 16
4: 248
Right 1049463559 8:142740974-142740996 CGTGGGGTATGGAAGGCAGAGGG 0: 1
1: 0
2: 2
3: 14
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049463559 Original CRISPR CGTGGGGTATGGAAGGCAGA GGG Exonic
900320283 1:2080106-2080128 CCTGGGACCTGGAAGGCAGAGGG - Intronic
900760101 1:4464536-4464558 TCTGGGCTAAGGAAGGCAGACGG + Intergenic
900798475 1:4723630-4723652 CGAGGGCGATGGAAGGGAGACGG + Intronic
901027161 1:6284798-6284820 GGTGGGGTGTGGAAAGCAGGGGG - Intronic
901316790 1:8315123-8315145 TGTGGGGGAAGGATGGCAGAGGG - Intergenic
901651623 1:10746503-10746525 CATGGGGCTGGGAAGGCAGAAGG - Intronic
901817163 1:11800878-11800900 AGTGGTGTAGGCAAGGCAGAGGG + Intronic
902048338 1:13542501-13542523 AGTGTGTTCTGGAAGGCAGAAGG + Intergenic
902883294 1:19387051-19387073 CGTGGTGCATGGCAGGCACATGG - Intronic
903321866 1:22548167-22548189 AGAGGGGTGTGGAAGGGAGAGGG - Intergenic
903329706 1:22590988-22591010 CGTGGGGGGTGGAAGTCAGTTGG - Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903835347 1:26200062-26200084 CGTGGGATGGGGAGGGCAGAAGG + Intronic
904328661 1:29744104-29744126 TGTGGGGTATGGAAGTTAGTGGG + Intergenic
904339990 1:29828333-29828355 GGTGGGGCAGGGAAGGCAGGTGG + Intergenic
904870975 1:33617973-33617995 CTTAGGGTAAGGAAGACAGAGGG - Intronic
905425005 1:37876467-37876489 CTTGGGGTAGCCAAGGCAGAAGG + Intronic
905581558 1:39086340-39086362 AGTGGGGCCTGGAAGGCAGGAGG + Intronic
907705116 1:56826223-56826245 GGTGGGGGATTGAAGGCAGGGGG - Intergenic
908117147 1:60951382-60951404 AGTAGAGTATGGAAGGCTGAAGG + Intronic
908508137 1:64826561-64826583 AGTGGGGTCGGGGAGGCAGAGGG + Intronic
910315107 1:85873679-85873701 CGTGGGGTAGGGGAGGGGGAAGG + Intronic
911088787 1:94001256-94001278 TGTAGGGTAGGGAAGGCAGGAGG + Intronic
914782583 1:150799196-150799218 AGTGGGATATGGAATCCAGAAGG - Exonic
915740980 1:158118216-158118238 TGGGGGATATGGAAGGCAGCGGG - Intergenic
917347814 1:174046837-174046859 CATGGCGGAAGGAAGGCAGAAGG + Intergenic
921173115 1:212566514-212566536 GGTGGGGTAAGGCAGGCTGAGGG + Intronic
923465675 1:234246187-234246209 CTTGGGGTTTGGGAGGCAGGAGG + Intronic
923521376 1:234737574-234737596 GCTTTGGTATGGAAGGCAGAAGG + Intergenic
923715762 1:236423768-236423790 CATGGGGTATGGAAGCCTTAAGG + Intronic
924139865 1:241011266-241011288 CTTGGGGACTGAAAGGCAGAAGG + Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1067476835 10:46573045-46573067 CCTGGAGTTTGGGAGGCAGACGG - Intergenic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1067617902 10:47768735-47768757 CCTGGAGTTTGGGAGGCAGACGG + Intergenic
1069780606 10:70953101-70953123 GGTTGGGAGTGGAAGGCAGATGG - Intergenic
1070395588 10:76009044-76009066 CCTGGGGTAGGGATGGCAGCAGG + Intronic
1070567639 10:77615687-77615709 CGTGGGTGATGAGAGGCAGAGGG + Intronic
1071289287 10:84176946-84176968 AGTGGGGTATGGAAGACAGATGG + Intronic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1072234146 10:93438682-93438704 CTAGGGATAGGGAAGGCAGAAGG + Intronic
1072898523 10:99387805-99387827 CGTGTGATCTGGAAGGAAGAGGG - Exonic
1075067586 10:119299953-119299975 CGTGGGGTGGGGAAGGGGGAGGG - Intronic
1075642086 10:124072136-124072158 CTTGGGGTAGGGAAGACAGCCGG + Intronic
1075726032 10:124611394-124611416 CTTGGAGGATGGAAGGGAGAGGG + Intronic
1076707821 10:132311392-132311414 CCTGGGAAATGGAAGACAGATGG + Intronic
1082932320 11:58621453-58621475 CATGGCTTTTGGAAGGCAGAAGG - Intronic
1083235193 11:61346570-61346592 GGTGAGGGTTGGAAGGCAGAAGG - Exonic
1083352024 11:62036581-62036603 AGTGGGGGATGGAAGGGAAATGG - Intergenic
1084461852 11:69300608-69300630 AGTAGGGTGTGGAAGGCTGAGGG + Intronic
1085011220 11:73142642-73142664 CGTGGGGGAGGGAGGGCAGGAGG - Intergenic
1090319881 11:125833058-125833080 TATGGGGCAGGGAAGGCAGAGGG + Intergenic
1091159734 11:133409090-133409112 CGTGGGCTGTGGAAGGAAGGAGG + Intronic
1091818229 12:3455366-3455388 CTTGGGGTGTGGAAGGCAAGAGG + Intronic
1092119477 12:6034020-6034042 AGTGGGGAGTGGGAGGCAGAGGG + Intronic
1092727900 12:11501915-11501937 CATGGGGGATGGTTGGCAGATGG + Intergenic
1095902657 12:47344427-47344449 GGTGGTGTATGGAAGACAGGAGG - Intergenic
1096846137 12:54408076-54408098 AGTGGGGAAGGGATGGCAGAGGG - Intronic
1097700093 12:62811097-62811119 CATGGGGTATGGGGGGCACACGG + Intronic
1098170998 12:67747194-67747216 GGTGGGGGTGGGAAGGCAGAGGG + Intergenic
1102476848 12:113194330-113194352 TGTGGTGTATGTAAGGCAGTTGG + Intergenic
1102495386 12:113315783-113315805 TGTGGGGCCTGGAAGGCAGGTGG - Intronic
1102571895 12:113831825-113831847 CGTGGGGAGTGGAAGGAAGTAGG + Intronic
1103241920 12:119420573-119420595 AGTGGGGGATGGGGGGCAGAAGG + Intronic
1104953235 12:132451669-132451691 GGTGGAGGTTGGAAGGCAGAGGG + Intergenic
1105707232 13:22975654-22975676 AGTGTGGTATGGAAGGCAGGTGG - Intergenic
1106962098 13:35010638-35010660 CTTGGGGAATCTAAGGCAGAAGG + Intronic
1107124727 13:36834245-36834267 GGTGGTGCATGGAAGACAGAGGG - Intergenic
1107305444 13:39013669-39013691 TGTGGGGTAGGGATGGCTGATGG + Exonic
1108394905 13:49982518-49982540 TGTGGGGTATGCAGGGAAGAAGG + Intergenic
1113409273 13:110070208-110070230 GGTGGGGAAGGGAGGGCAGAGGG - Intergenic
1115302447 14:31899681-31899703 GGTGGGATATAGAAGGGAGAAGG + Intergenic
1116225145 14:42141040-42141062 ATTGGGGTATGGAAGGTAGTAGG + Intergenic
1116764285 14:49051476-49051498 CGTGGGGTAAAGACGTCAGAAGG - Intergenic
1116923485 14:50607399-50607421 TGTGGGTTATGGAAGCAAGATGG + Intronic
1117850637 14:59965336-59965358 CTTGGGGTAAGGAATGCAAAGGG - Intronic
1119298602 14:73552919-73552941 CATGGGGGATGGAAGGGAGCTGG - Intronic
1119302896 14:73585095-73585117 CATGGGGGATGGAAGGGAGCTGG - Intergenic
1119711960 14:76828888-76828910 CCTGGGATATGGAATACAGAAGG - Intronic
1121852749 14:97237042-97237064 CATGGGGTATGGTGGGCAGCAGG - Intergenic
1122625364 14:103082847-103082869 GTTGGGTTATTGAAGGCAGATGG + Intergenic
1122625373 14:103082891-103082913 GTTGGGTTATTGAAGGCAGATGG + Intergenic
1122864033 14:104595514-104595536 TGTGGGGCATGGGGGGCAGAGGG - Intronic
1122864065 14:104595629-104595651 TGTGGGGCATGGGGGGCAGAGGG - Intronic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1124023081 15:25941566-25941588 CGTGGGATCTGGAAGCCAGCTGG + Intergenic
1126825372 15:52543043-52543065 GGTGGGGTATGAAGGGAAGAGGG - Intergenic
1128237491 15:66078041-66078063 GGTTGGGGAGGGAAGGCAGAGGG + Intronic
1129137791 15:73569862-73569884 CATGGGGCCTGAAAGGCAGATGG + Intronic
1129508978 15:76106137-76106159 GCTGGGGGATGGGAGGCAGAGGG - Intronic
1129828372 15:78650616-78650638 TGTGTGATTTGGAAGGCAGAAGG + Intronic
1130827687 15:87566187-87566209 ATTGGGGTAAGGAAGGCACAAGG + Intergenic
1130974401 15:88762231-88762253 CATGGGATAGGGAAGCCAGATGG - Intergenic
1132156656 15:99500509-99500531 AGTGGGGTAGGGCAGGCTGATGG + Intergenic
1132983076 16:2749213-2749235 CATGGGGCCTGGAAGCCAGAAGG + Intergenic
1138229140 16:55324861-55324883 CGTGGGGTCCGGAAGACAGAAGG - Exonic
1138239503 16:55415688-55415710 CTTGGAGGATGGAGGGCAGATGG + Intronic
1138510838 16:57507680-57507702 CCTGGGGCCTGGGAGGCAGATGG + Intergenic
1140766928 16:78168548-78168570 CTTGGAGTTTGGAAGCCAGATGG - Intronic
1141196452 16:81865043-81865065 CCTGGGGGAAGGAAGGCAGCTGG + Intronic
1142212770 16:88816321-88816343 GATTGGGTGTGGAAGGCAGAAGG + Intronic
1142285232 16:89168903-89168925 TGTGGGGCGTGGAGGGCAGAAGG - Intergenic
1142403209 16:89871876-89871898 CGTGGGGCCTGGAGGTCAGAAGG + Intergenic
1146125839 17:30230711-30230733 GGTGGGGCATGGAGGGGAGAAGG + Intronic
1146678184 17:34788085-34788107 TGTGGAGTATGGGAGGGAGATGG - Intergenic
1146905186 17:36613527-36613549 CCTGGGGAAGGGGAGGCAGAGGG - Intergenic
1146915631 17:36676648-36676670 CATGGGCTAAGGAATGCAGATGG + Intergenic
1147265604 17:39232461-39232483 CGAGTGGACTGGAAGGCAGAGGG + Intergenic
1147978124 17:44259455-44259477 CGAGGGGTGTGGAGGGCTGAGGG + Intronic
1148076782 17:44941714-44941736 CCCGGGGAAGGGAAGGCAGAGGG + Intronic
1148677046 17:49451661-49451683 CATGGAGCAAGGAAGGCAGAGGG - Intronic
1148940485 17:51205634-51205656 CGTGCTGTATGAAAGGGAGAGGG + Intronic
1151277457 17:73046382-73046404 CCTGGGAGATGGAAGGCAGGAGG + Intronic
1151694153 17:75705589-75705611 CCTGGGGTTTGGAAGGGAGAGGG - Intronic
1151732517 17:75919895-75919917 CATGGCGCAAGGAAGGCAGAGGG + Intronic
1153143062 18:1996887-1996909 CTTGGTGTTTGGAAGGCTGAAGG + Intergenic
1157317257 18:46602576-46602598 TGTGGGGTATGGTAGGGTGAGGG - Intronic
1157531937 18:48428720-48428742 CGTGGGATGGGGAAGGCAGCTGG - Intergenic
1160337440 18:78054951-78054973 TGGGGGGTTGGGAAGGCAGATGG + Intergenic
1163554010 19:17982498-17982520 CGTGGGAGATGGGAGACAGAGGG - Intronic
1167109019 19:47447889-47447911 CGTGCGGTAGGGAAGGCGCACGG + Exonic
1167269908 19:48500882-48500904 TGAGGGGTATGGAGGGCAAACGG + Intronic
1167707467 19:51090136-51090158 GGTGGGGTTGGGAAGGCTGAGGG + Intergenic
926001604 2:9338050-9338072 CGTGGGATGGGGAAGGCAGGAGG - Intronic
926483928 2:13432225-13432247 TCTGGGGTATGGAAGACAGTGGG + Intergenic
926546146 2:14242737-14242759 CCTGAAGTTTGGAAGGCAGAGGG + Intergenic
927503066 2:23595213-23595235 TGTGGGGTGTGGAAAGGAGAGGG + Intronic
928084753 2:28339090-28339112 GGAGGGGTATGGATGGCAGCGGG - Intergenic
929589134 2:43133930-43133952 CCTGGGGTAGGGAAGGCGGCAGG + Intergenic
929832648 2:45359453-45359475 CGTGGGTTAAGAAAGGCTGATGG + Intergenic
930882931 2:56292485-56292507 AGAGGGTTGTGGAAGGCAGAGGG - Intronic
933679737 2:85089255-85089277 TGTGGGGTGAGGAAGGCAGGTGG - Intergenic
934309431 2:91850144-91850166 CGTGGGATAGGGAAGGATGAGGG - Intergenic
934942019 2:98509625-98509647 TGTGTGGTGTGGAAGGCAGTCGG + Intronic
935999363 2:108811143-108811165 AGGGGGGTAGGGAAGGCAGAGGG - Intronic
937825546 2:126365130-126365152 CCTGGGGTATGGAAACCTGATGG - Intergenic
937993999 2:127679615-127679637 CCTGGAGTAGGGAAGGGAGAAGG - Intronic
940497632 2:154453545-154453567 CAGGGGATAGGGAAGGCAGATGG - Exonic
940589932 2:155710077-155710099 TTTGGGGTAAGGAAGACAGAGGG + Intergenic
941518919 2:166513319-166513341 GGTGGGGTTTGGAAGGATGATGG - Intergenic
942784606 2:179686465-179686487 CTTGGGGAAAGGAAGGCTGAAGG + Intronic
944680829 2:202075154-202075176 CCTGGCATATGGAAGGCAGCAGG + Exonic
946412115 2:219520595-219520617 CGTTGGCTGTGGAAGGGAGAGGG + Intronic
946821933 2:223639068-223639090 CATGGGATTTGAAAGGCAGAAGG - Intergenic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
1168884812 20:1241617-1241639 GGAGGGGTATGGAAGGTGGAAGG + Intronic
1169186816 20:3625130-3625152 CGTGGGGTGGGGAAGGCGCAAGG - Intronic
1169303578 20:4468889-4468911 AGTGGGGAATGAAGGGCAGAGGG - Intergenic
1170629256 20:18054340-18054362 CCTGGGGTGTGCAAGGCAGCAGG - Intronic
1170821455 20:19758503-19758525 CGTGGGGAACGGAAGGGGGAAGG + Intergenic
1172124069 20:32614683-32614705 AGTAGGGTTTGGAAGGCAGCAGG - Intergenic
1173782907 20:45771534-45771556 AGTGGGGTGAGGAAGGCAGGAGG - Intronic
1173875268 20:46366489-46366511 CCTGGGGTCTGGAAGGCCAAAGG + Exonic
1175278636 20:57788193-57788215 TGTGGGGTACGGCAGGCTGAGGG + Intergenic
1175368392 20:58470802-58470824 AGTGGGGTTGGGAGGGCAGATGG - Intronic
1175504282 20:59470735-59470757 CGTGGGGATTGGAGGCCAGAAGG - Intergenic
1175605363 20:60308233-60308255 CCTGGTGCGTGGAAGGCAGAAGG - Intergenic
1175659861 20:60803441-60803463 CCTGAGGTTTGGAAGGCAGATGG + Intergenic
1175976013 20:62710876-62710898 GGTGGGCTAAGGAAGCCAGAGGG + Intronic
1176301647 21:5101592-5101614 CGTGGGGCAGGGCAGGGAGAGGG + Intergenic
1179855384 21:44160307-44160329 CGTGGGGCAGGGCAGGGAGAGGG - Intergenic
1184871933 22:47246098-47246120 TGTGGGGCATGGAAGGGAGCGGG + Intergenic
950413064 3:12851454-12851476 TGTGGGGTGCAGAAGGCAGAGGG - Intronic
950526620 3:13528272-13528294 CCTGAGGTATGCCAGGCAGAAGG + Intergenic
950644807 3:14370866-14370888 CCTGGGGCAGGGCAGGCAGAAGG - Intergenic
953759297 3:45674253-45674275 CGTGGGGTGGGGAGGGAAGAGGG - Intronic
954584470 3:51721281-51721303 GGGGGGTTATGGGAGGCAGAGGG + Intergenic
956093104 3:65688569-65688591 CGTGGGGTAGGGAAGATAGCAGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
959572477 3:107899755-107899777 CAAGGGAGATGGAAGGCAGATGG - Intergenic
959702930 3:109315448-109315470 GGTGGAGTAACGAAGGCAGAAGG + Intronic
961175074 3:124828496-124828518 CCTGGGGTAAGGGAGGCAGGAGG + Intronic
964055433 3:152450524-152450546 TGTGGGGTCTGGGAGGCACAGGG + Intronic
967204070 3:187103503-187103525 CCTGGGGCATGGAAGGCTGGAGG - Intergenic
967338207 3:188368014-188368036 TGTGGGGAAGGGAGGGCAGATGG - Intronic
968287212 3:197515940-197515962 AGTGTGGTATGGAAGGGAGATGG - Intronic
968551529 4:1226055-1226077 GGTGGGGCATGGAGGGCGGAAGG - Intronic
968873617 4:3253979-3254001 GGTGTGGGATGGATGGCAGAGGG - Intronic
971298626 4:25423890-25423912 AGTGGGGTATTGAGAGCAGAAGG + Intergenic
972506262 4:39723124-39723146 CCTGGAGTCTGGAAGGCAGGGGG - Intronic
974971009 4:68826974-68826996 TGTGGGGTGTGCAAGGCAGCAGG - Intronic
974984773 4:69009410-69009432 TGTGGGGTGTGCAAGGCAGCAGG + Intronic
974999538 4:69204982-69205004 TGCGGGGTATGCAAGGCAGCAGG + Intronic
975006235 4:69290237-69290259 TGTGGGGTGTGCAAGGCAGCAGG - Intronic
975014649 4:69399181-69399203 TGTGGGGTGTGCAAGGCAGCAGG - Intronic
975015899 4:69418591-69418613 TGCGGGGTATGCAAGGCAGCAGG - Intronic
975940506 4:79638937-79638959 GGAGGAGTATGGCAGGCAGAGGG - Intergenic
976816782 4:89157673-89157695 AGTAGGGAATGGAAGACAGATGG + Intergenic
980724130 4:136736070-136736092 TGTGGAGTATGGAAGGTAGTTGG - Intergenic
985747188 5:1654143-1654165 CGTGGGTGACGGAAGACAGAGGG + Intergenic
985817029 5:2134726-2134748 CCTGGGGTATGGAAGCCTGACGG + Intergenic
986471563 5:8081542-8081564 CTTGGGGCAAGGAAGGCAGAGGG + Intergenic
986565673 5:9111299-9111321 AAATGGGTATGGAAGGCAGAGGG + Intronic
987029098 5:13959621-13959643 CTTGGGGTAAGGAATGAAGAGGG - Intergenic
987278025 5:16382922-16382944 CCGGGGTGATGGAAGGCAGAGGG - Intergenic
990700325 5:58467956-58467978 AGTTGGGTATGGAAGGAAGAGGG - Intergenic
992077618 5:73205674-73205696 TGAGGGGTAAGGAAGGCAGCAGG - Intergenic
994127049 5:96179660-96179682 AGAGGGGTATTTAAGGCAGAGGG + Intergenic
994427051 5:99603206-99603228 CATGTGGTAAGGAAGGCAGATGG + Intergenic
995611920 5:113920002-113920024 CCTGGGCTATGAAATGCAGAGGG - Intergenic
997363311 5:133309246-133309268 CGTGGGGAAGGAGAGGCAGAGGG + Intronic
997816312 5:137022163-137022185 AATGTGGTATGGAAGGGAGAAGG - Intronic
998003006 5:138639501-138639523 GGTGGAGCCTGGAAGGCAGAGGG - Intronic
998500576 5:142628988-142629010 CCTGGGGTGGGGAAGACAGAAGG + Intronic
999295273 5:150455672-150455694 GCTGGGGTAGGGAAGGCAGAGGG + Intergenic
999758869 5:154684910-154684932 AGTGGGATATGGAAGGGATATGG + Intergenic
1002003442 5:176212877-176212899 CCTGAGGTAAGTAAGGCAGATGG - Intergenic
1002192378 5:177485034-177485056 CGTGGTGCAGGGAAGGCAGCTGG - Intronic
1004119053 6:12801548-12801570 GACGGGGTATGGATGGCAGAAGG + Intronic
1004398758 6:15269468-15269490 GGTGGGGCAGGGAAGGCAGGAGG - Intronic
1004562204 6:16761325-16761347 CGTGGGGAAGGGGGGGCAGAGGG + Exonic
1004697189 6:18044457-18044479 CGTGGTGCATGTAAGGGAGAAGG - Intergenic
1007404085 6:41623631-41623653 GGTGGGGAATGGAAGGTGGAAGG - Intergenic
1007555460 6:42762036-42762058 CGTGGTGACTGGAAGGCAGAAGG - Intronic
1010523976 6:76877108-76877130 GGTGGGATATGGCAGGAAGAAGG - Intergenic
1014747083 6:125213329-125213351 CCTGGTGTATGGAAGCCTGAAGG + Intronic
1015181242 6:130365312-130365334 CGGGGGAAATGGAAGACAGAGGG - Intronic
1017320589 6:153088022-153088044 AGTGAGGAATGGAAGGGAGAGGG - Intronic
1017415827 6:154219566-154219588 AGTGGGATGTGGAAGGCACAAGG - Intronic
1019493892 7:1327758-1327780 GGTGGGGAAAGGAAGGCAGCAGG - Intergenic
1019571942 7:1716918-1716940 CATGGGGCATGGGAGCCAGAGGG + Intronic
1019710545 7:2516396-2516418 CCCGGGGGAGGGAAGGCAGATGG + Intronic
1019809909 7:3157774-3157796 CGTGGGCTATGAAAGACAGGAGG + Intronic
1023291342 7:38671811-38671833 GGTGGGGAATGGGAGGCAAAGGG + Intergenic
1023863077 7:44227025-44227047 AGGGGGGTGTGGAAGACAGAGGG + Intronic
1029201430 7:98841863-98841885 CGGGGGGCATGGCGGGCAGAGGG - Intergenic
1030253917 7:107484995-107485017 CGTGGGGTAAGGGAAGGAGAAGG - Intronic
1030269761 7:107658639-107658661 AGTGGGGTAAGGCTGGCAGAAGG - Intergenic
1030352336 7:108503938-108503960 CATGAGGTGTGGAAGGCAAAAGG + Intronic
1032425069 7:131815969-131815991 CCTGGGGAATAGAGGGCAGAGGG - Intergenic
1035117128 7:156533832-156533854 CCTGGGGCAGTGAAGGCAGAAGG + Intergenic
1035348243 7:158222561-158222583 CGAGGACTATGAAAGGCAGAGGG + Intronic
1035762854 8:2082029-2082051 GGTGGGTTATGGGAGGCTGAGGG + Intronic
1036500285 8:9307959-9307981 GGTGGGGGGTTGAAGGCAGACGG + Intergenic
1039906729 8:41791831-41791853 CATGGTGTCTGGAAGGCAGCGGG - Intronic
1042811742 8:72833140-72833162 CGTTGGTTTTGGAAAGCAGAAGG + Intronic
1047120701 8:121901213-121901235 CTTGGGAAATGAAAGGCAGATGG - Intergenic
1048881674 8:138877098-138877120 GGTGGGGGAGGGGAGGCAGAGGG - Intronic
1049224519 8:141443471-141443493 GGAGGAGTATGGAAAGCAGAGGG - Intergenic
1049463559 8:142740974-142740996 CGTGGGGTATGGAAGGCAGAGGG + Exonic
1051220451 9:14843269-14843291 AGTGGGGTAGGGAAGGTGGAGGG - Intronic
1053365927 9:37522605-37522627 CGTGGGGTTAGCAAAGCAGAAGG - Intronic
1053661343 9:40283653-40283675 AGGGGTGTGTGGAAGGCAGAAGG + Intronic
1053911718 9:42912999-42913021 AGGGGTGTGTGGAAGGCAGAAGG + Intergenic
1054373462 9:64429871-64429893 AGGGGTGTGTGGAAGGCAGAAGG + Intergenic
1054523267 9:66092631-66092653 AGGGGTGTGTGGAAGGCAGAAGG - Intergenic
1054681091 9:67919642-67919664 AGCGGTGTGTGGAAGGCAGAAGG + Intergenic
1056101307 9:83302875-83302897 CGGGTGGAAAGGAAGGCAGAAGG - Intronic
1057205694 9:93171150-93171172 TGTGGGGTATGGACCACAGAGGG - Intergenic
1057482444 9:95456069-95456091 AGAGGGGTATGGAAGGTACATGG - Intronic
1059268940 9:113060602-113060624 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059270076 9:113066051-113066073 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059271210 9:113071499-113071521 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059272343 9:113076945-113076967 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059273478 9:113082387-113082409 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059274614 9:113087833-113087855 GGTGGGGGATGGAGGGCAGGGGG - Intergenic
1059411698 9:114136594-114136616 GGTGGGGTCTGGAAAGGAGATGG - Intergenic
1059767510 9:117397539-117397561 CATGGTTTATGGAAGACAGATGG + Intronic
1060169336 9:121448157-121448179 AAAGGGGTAAGGAAGGCAGAGGG - Intergenic
1060341425 9:122780107-122780129 CGAAGGGAATGGAAGGGAGAAGG - Intergenic
1061881555 9:133571587-133571609 CGTGGGGCCCAGAAGGCAGAGGG - Intronic
1062020896 9:134319008-134319030 CCTGGGGTGTGGAAATCAGACGG + Intronic
1185669028 X:1791152-1791174 TGGGGGGTATGGGAGGTAGAAGG - Intergenic
1187051091 X:15696258-15696280 AGTGGGGGATGAAAGGGAGAAGG - Intronic
1190107383 X:47570068-47570090 TGTGGGGTATGGATGCCTGAGGG - Intronic
1192146542 X:68686503-68686525 CGTGGGGTGTGGAGGGCACCCGG + Intronic
1192504092 X:71670426-71670448 CATGGGGTATGGTAGGCAGAGGG - Intergenic
1192538634 X:71949819-71949841 CTTGGTATGTGGAAGGCAGAGGG - Intergenic
1193403687 X:81076915-81076937 CATGGGGTGTGGAGGGCAGGGGG + Intergenic
1194994049 X:100573983-100574005 TGTGGGTTAGGGAAGGCACAGGG - Intergenic
1198089043 X:133309554-133309576 CATTGGGAATGGAATGCAGAAGG - Intronic
1198177695 X:134172507-134172529 CTTGGGCTATTAAAGGCAGAGGG - Intergenic
1198276148 X:135097741-135097763 CCTGGGGAATGGAAGGTAGTGGG - Intergenic
1199087638 X:143646909-143646931 GGTGGGGTATGGAACGCATCAGG - Intergenic