ID: 1049465759

View in Genome Browser
Species Human (GRCh38)
Location 8:142750624-142750646
Sequence CAACGTCGGTGGGAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049465759_1049465767 1 Left 1049465759 8:142750624-142750646 CCTCTCTCCTCCCACCGACGTTG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1049465767 8:142750648-142750670 CCGGGTGTCTACCATGTGCCAGG 0: 1
1: 1
2: 4
3: 109
4: 520
1049465759_1049465772 18 Left 1049465759 8:142750624-142750646 CCTCTCTCCTCCCACCGACGTTG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1049465772 8:142750665-142750687 GCCAGGCACCCGGCCTGATGGGG 0: 1
1: 0
2: 1
3: 18
4: 215
1049465759_1049465770 16 Left 1049465759 8:142750624-142750646 CCTCTCTCCTCCCACCGACGTTG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1049465770 8:142750663-142750685 GTGCCAGGCACCCGGCCTGATGG 0: 1
1: 0
2: 1
3: 15
4: 182
1049465759_1049465771 17 Left 1049465759 8:142750624-142750646 CCTCTCTCCTCCCACCGACGTTG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1049465771 8:142750664-142750686 TGCCAGGCACCCGGCCTGATGGG 0: 1
1: 0
2: 1
3: 7
4: 106
1049465759_1049465768 8 Left 1049465759 8:142750624-142750646 CCTCTCTCCTCCCACCGACGTTG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1049465768 8:142750655-142750677 TCTACCATGTGCCAGGCACCCGG 0: 3
1: 8
2: 46
3: 251
4: 834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049465759 Original CRISPR CAACGTCGGTGGGAGGAGAG AGG (reversed) Intronic
903102174 1:21040171-21040193 CAACCTCAGGGGAAGGAGAGGGG + Intronic
903374288 1:22856139-22856161 CAGAGTCCCTGGGAGGAGAGGGG + Intronic
907305611 1:53511421-53511443 CAACGTTGGAGGGAGCAGAGAGG - Intronic
908180088 1:61595139-61595161 CAACATCAGTTGGGGGAGAGAGG - Intergenic
908777367 1:67653459-67653481 CAAAGTCCCTGGGAGAAGAGAGG - Intergenic
910199296 1:84681981-84682003 CAACCTTGGTAGGAGGAAAGAGG + Intronic
911921017 1:103761382-103761404 CAAAGGAGGTGGGAGGAAAGAGG - Intergenic
915152141 1:153842468-153842490 CAACATCTGAAGGAGGAGAGAGG - Intronic
916896620 1:169170182-169170204 TACTGTGGGTGGGAGGAGAGGGG + Intronic
919941474 1:202289540-202289562 GAACGTAGGTGGAAGGAGGGAGG + Intronic
1063365407 10:5487413-5487435 CAACGTGGTTGTGAGGAGGGTGG - Intergenic
1065511437 10:26482333-26482355 CAACGTTTGAGGGAGGAGAAAGG - Intronic
1065717121 10:28582014-28582036 CAACGTAGGTGGTATGATAGAGG - Intronic
1068844583 10:61657745-61657767 CAAAGTTGGTGGGTGGAAAGTGG + Intergenic
1069383300 10:67862135-67862157 CAAGGTCAGGGGGAGGAGGGTGG - Intergenic
1074316850 10:112368973-112368995 AAACGTAGGTGGCTGGAGAGAGG + Intergenic
1074434516 10:113422574-113422596 CAACATTGGTGGGCGGGGAGAGG - Intergenic
1075075715 10:119349030-119349052 CACGGTGGGTGGGAGGAGGGCGG - Intronic
1076571697 10:131437436-131437458 CACCTTCCGTGGGTGGAGAGAGG - Intergenic
1080083628 11:28252264-28252286 AAATGTTGGTGGGAGGAGTGGGG + Intronic
1081781651 11:45717047-45717069 GCAGGCCGGTGGGAGGAGAGTGG - Intergenic
1083272011 11:61577380-61577402 GGAGGTAGGTGGGAGGAGAGAGG + Intronic
1083721673 11:64606640-64606662 CAGAGTCGGTGGGAGAAGGGCGG - Exonic
1084084335 11:66847984-66848006 GAATGTTGGTGGGAGGTGAGGGG - Intergenic
1084220300 11:67673823-67673845 CAAGGCTGGTGTGAGGAGAGGGG - Intronic
1084511261 11:69605713-69605735 GACCGTGGGTGGAAGGAGAGGGG - Intergenic
1088110562 11:106256273-106256295 CAAGGACAGTGGAAGGAGAGGGG - Intergenic
1089493222 11:118896363-118896385 TGGCGTGGGTGGGAGGAGAGGGG + Exonic
1095983581 12:47985893-47985915 CAAGGTGAGTGGGAGAAGAGGGG - Exonic
1098774612 12:74596065-74596087 CAAAGTGGCTGGGAGGACAGAGG + Intergenic
1099533840 12:83821568-83821590 TAAAGTTGGTGGGAGGAGGGAGG + Intergenic
1102011389 12:109620933-109620955 CAACGACGGAGCCAGGAGAGAGG - Intergenic
1103964918 12:124632589-124632611 CATCTGAGGTGGGAGGAGAGAGG + Intergenic
1106269556 13:28139312-28139334 GAACGTGGGTGGGAGGACTGGGG + Intronic
1111555266 13:89872868-89872890 CAAAGTCAGTGGGAAAAGAGGGG - Intergenic
1111595219 13:90402948-90402970 CAAAGTGGGTGGGTTGAGAGAGG + Intergenic
1112441428 13:99427121-99427143 CAGGGTGGGAGGGAGGAGAGAGG + Intergenic
1113415262 13:110123840-110123862 CAAAGTCCGTGGGAGGGAAGAGG + Intergenic
1114198403 14:20499833-20499855 CAAAGTCTGTGGTGGGAGAGGGG - Intergenic
1115389594 14:32840012-32840034 GAATGTCTTTGGGAGGAGAGGGG - Intergenic
1120765210 14:88322595-88322617 CAGCGCGGGTGGGAGGAGGGCGG - Intronic
1121309693 14:92929116-92929138 CAGCGGCGGCGGGGGGAGAGGGG + Intronic
1122773269 14:104106472-104106494 CGACGGCGGTGGGAGCAGACGGG + Intronic
1128102262 15:65012157-65012179 AAAGGTGGGTGGGAGGGGAGAGG + Intronic
1129784447 15:78299724-78299746 CGACGAGGGTGGGCGGAGAGAGG + Exonic
1130991666 15:88879329-88879351 CAGTGAAGGTGGGAGGAGAGCGG - Intronic
1133334959 16:5000964-5000986 CAAAGACGGAGGGTGGAGAGGGG + Intronic
1134796123 16:17038683-17038705 CACCGTGAGTGGGAGGTGAGTGG - Intergenic
1134898769 16:17915132-17915154 CAACATCTGGGGGTGGAGAGAGG + Intergenic
1136029374 16:27491737-27491759 CCATGTGGGTAGGAGGAGAGTGG - Intronic
1138230229 16:55331142-55331164 CAGGGTCGGTGTGAGGCGAGAGG + Intergenic
1138291103 16:55847404-55847426 AAATGTGTGTGGGAGGAGAGAGG - Intronic
1140824567 16:78693851-78693873 CAACTTCAGTGGGAAAAGAGAGG - Intronic
1141620769 16:85235641-85235663 CACCCTCGGGGGGAGGAGGGGGG - Intergenic
1142610972 17:1109113-1109135 CAGCGGCGGCGGGAGGAGGGAGG + Intronic
1143779668 17:9222603-9222625 AAACGGCGGTGGAAGAAGAGGGG + Intronic
1147258731 17:39196809-39196831 CAACGTGGGTGTGGGGGGAGGGG + Intronic
1147303754 17:39549486-39549508 TAACTTCGGTGGGAGCAGATGGG - Intronic
1147934827 17:44005418-44005440 CAAGGTCGGAGGGAGGAGGGCGG + Intronic
1148262057 17:46192957-46192979 GGGCGTCGGGGGGAGGAGAGCGG - Intronic
1149637892 17:58185000-58185022 CAAGGCAGGAGGGAGGAGAGAGG + Intergenic
1151342943 17:73483245-73483267 CTACATAGATGGGAGGAGAGTGG + Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152931463 17:83112186-83112208 CAACGCCCGGGGGTGGAGAGAGG - Intergenic
1154162891 18:11993265-11993287 TAACATCAGTGGGAGTAGAGAGG - Intronic
1155532088 18:26777521-26777543 AAAAGAAGGTGGGAGGAGAGCGG - Intergenic
1160357191 18:78238677-78238699 CACCGTGGGCGGGAGGCGAGAGG + Intergenic
1160859207 19:1230640-1230662 CCACGTCGGTGGGATGGGAATGG - Exonic
1160878473 19:1308789-1308811 GAACGTGGATGGCAGGAGAGAGG + Intergenic
1161596288 19:5152599-5152621 CAGCGTGGGTGGGTGGAGCGAGG - Exonic
1163186425 19:15642172-15642194 CAAGGTCTGGGGGAGGAGAAAGG - Intronic
1163725870 19:18922759-18922781 GAAGGGCGGTGGGAGGGGAGAGG - Intronic
1166951001 19:46428071-46428093 CAAGGGCGGTGTGTGGAGAGTGG - Intergenic
1167583073 19:50357884-50357906 CAACATGGGTGGGAGGCGACAGG - Intronic
932728414 2:74199252-74199274 CACCGGCGGAGGGAGGAGGGCGG - Intronic
934618930 2:95792377-95792399 CAAAGTCCTTGGCAGGAGAGAGG - Intergenic
934641962 2:96032180-96032202 CAAAGTCCTTGGCAGGAGAGAGG + Intronic
936861679 2:117027487-117027509 CACCCTGGGTGGGAGGAGTGGGG - Intergenic
938409862 2:131054994-131055016 CATAGGGGGTGGGAGGAGAGGGG + Intronic
939467278 2:142574295-142574317 TATCGTCGGTGGGAGGGGGGTGG + Intergenic
942371864 2:175294108-175294130 CAAGGTCAGGGGGAGGAGGGTGG + Intergenic
943863675 2:192899633-192899655 CAACGTGGATGGGACGGGAGAGG - Intergenic
944546667 2:200805586-200805608 CAATGTTGGTGGGAGGTGATTGG + Intergenic
944840846 2:203622108-203622130 CATTGGCGGTGGGGGGAGAGAGG + Intergenic
946172937 2:217906073-217906095 CAGGGCGGGTGGGAGGAGAGAGG - Intronic
946295687 2:218782022-218782044 CCGCGTCGCTGGGAGGAGCGAGG + Exonic
948810141 2:240470779-240470801 CAACGTGTCTGTGAGGAGAGGGG - Intergenic
1169017934 20:2306850-2306872 CAAGGTTGGCAGGAGGAGAGGGG + Intronic
1169022590 20:2340732-2340754 CAACCTGGGGGAGAGGAGAGGGG - Exonic
1169353123 20:4886109-4886131 CTGCCTGGGTGGGAGGAGAGTGG - Intronic
1169915803 20:10681865-10681887 CATTGTCAGTGGCAGGAGAGAGG + Intergenic
1170773225 20:19352116-19352138 CATTGTCGGTGGGAGGGGCGGGG + Intronic
1173681451 20:44885452-44885474 AAAAGGAGGTGGGAGGAGAGAGG - Intergenic
1176198256 20:63847862-63847884 CAAAGGCTGGGGGAGGAGAGGGG - Intergenic
1176884887 21:14243717-14243739 CAACATTGGTTGGGGGAGAGAGG + Intergenic
1177342261 21:19818870-19818892 CAACGTTGGTGGGAGGTGATTGG + Intergenic
1177922149 21:27165257-27165279 AAATGAGGGTGGGAGGAGAGAGG + Intergenic
1179071619 21:38076567-38076589 CAAGGCCTGGGGGAGGAGAGAGG - Intronic
1179959992 21:44762758-44762780 CAGCCCCTGTGGGAGGAGAGAGG + Intergenic
1183083960 22:35475129-35475151 CAAGGTCAGTGGGAGGTGGGTGG + Intergenic
1183585796 22:38752299-38752321 CACAGTCGGTGGGAGAAGAATGG + Intronic
1185058015 22:48591398-48591420 GCACGGGGGTGGGAGGAGAGCGG - Intronic
950187579 3:10954546-10954568 TGACGTGGGTGAGAGGAGAGAGG + Intergenic
950525437 3:13520247-13520269 CAACAGCTGTGGGAGGAGGGAGG - Intergenic
950545629 3:13636428-13636450 CCACGTCTGGGGGAGAAGAGGGG - Exonic
950774320 3:15336580-15336602 CAATGGAGGTTGGAGGAGAGAGG + Intronic
952830011 3:37556803-37556825 CACGGTCAGTGTGAGGAGAGAGG - Intronic
953320785 3:41969447-41969469 AAAGGTGAGTGGGAGGAGAGGGG - Intergenic
954919660 3:54179041-54179063 CAACCTTTTTGGGAGGAGAGGGG + Intronic
955422379 3:58751489-58751511 AAGCATGGGTGGGAGGAGAGGGG + Intronic
958122695 3:89312723-89312745 CATGGTAGGTGGGAGGAGGGAGG - Intronic
960257550 3:115527200-115527222 CAACCGGGGTGGGGGGAGAGGGG - Intergenic
961862922 3:129932045-129932067 CAACGTCTTTGGCAGAAGAGAGG - Intergenic
961868994 3:129974837-129974859 CACCGTCTGCGGAAGGAGAGGGG - Intronic
963289879 3:143476798-143476820 CAAAGTAGGAGGGAGGAGTGGGG + Intronic
967187083 3:186953509-186953531 CCAAGTCGGTGGGAGGAGACAGG - Intronic
967265435 3:187687238-187687260 CAACTTCTGGGAGAGGAGAGGGG + Intergenic
974069619 4:57111572-57111594 CAAAATCGGGGGGTGGAGAGTGG + Intergenic
980423204 4:132591976-132591998 CAAGGTCGATGGCAGAAGAGGGG + Intergenic
981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG + Intergenic
982065125 4:151648018-151648040 CAACCTCAGAGGCAGGAGAGTGG - Intronic
986077616 5:4354278-4354300 CAGCCTCGATGGGAGGGGAGGGG - Intergenic
987247117 5:16060238-16060260 CAACACCTGTGGGAGGAGTGGGG - Intergenic
990376153 5:55173154-55173176 CAGCGGCGGTGGGAGGAGTGGGG - Intronic
992211819 5:74487305-74487327 CAACATCTGTGGGACCAGAGAGG - Intergenic
993004453 5:82415548-82415570 CAATATGGGTGGAAGGAGAGTGG + Intergenic
997881968 5:137599711-137599733 CAAGGTGGGTAGGAGGAGATAGG + Intergenic
998131283 5:139652360-139652382 CAGCGTTGGGGGGAGGTGAGGGG - Intronic
1002467075 5:179412968-179412990 GAAGGTCGGTGGGGGGAGGGTGG - Intergenic
1003139277 6:3457142-3457164 CCACCTCGGCGGGGGGAGAGGGG - Intergenic
1003818070 6:9863873-9863895 CAATGTTGGTGGGAGGCGACTGG - Intronic
1006383717 6:33716798-33716820 CACCATCAGGGGGAGGAGAGAGG + Intergenic
1007716638 6:43859944-43859966 CAAAGTGGGGGTGAGGAGAGGGG + Intergenic
1020208938 7:6143246-6143268 CAGATTCGGTGGGAGGAGAGAGG + Intronic
1020679071 7:11214579-11214601 CAAAGTAAGTGAGAGGAGAGTGG - Intergenic
1023871382 7:44264721-44264743 CCACTTCAGTGGGAGGGGAGAGG - Intronic
1026235062 7:68520313-68520335 CAACATGGGAGGGAGGGGAGAGG - Intergenic
1029608261 7:101612985-101613007 GGACATCGGTGGGAGGAGAATGG - Intergenic
1031558931 7:123214512-123214534 CAATGTTGGTGGGAGGTGATTGG + Intergenic
1035162559 7:156961765-156961787 CAAGGCCAGTGGTAGGAGAGAGG + Intronic
1039035409 8:33354065-33354087 AAAAGTCGGCGGGAGGTGAGGGG - Intergenic
1040072828 8:43202224-43202246 CACCCTTCGTGGGAGGAGAGGGG - Exonic
1048824692 8:138412605-138412627 CAAGGCAGGTGGGAGGAGACAGG - Intronic
1049465759 8:142750624-142750646 CAACGTCGGTGGGAGGAGAGAGG - Intronic
1056125916 9:83536886-83536908 CCATGTCAGTGGGAGGTGAGTGG - Intronic
1056946926 9:91005516-91005538 AAATGTCTGTGGCAGGAGAGTGG - Intergenic
1058425056 9:104868969-104868991 CAAGGAAGGTGGGAGGAGGGAGG + Intronic
1059327539 9:113513291-113513313 CAACGGCGGTGTGGGGGGAGGGG - Intronic
1061074740 9:128334193-128334215 CAACTTCGGCCAGAGGAGAGGGG - Intergenic
1061453628 9:130681993-130682015 CCTCGTGGGTGGCAGGAGAGCGG + Exonic
1190318478 X:49165777-49165799 CAACGGAGGTGGGATGAGAGAGG + Intronic
1194755252 X:97731727-97731749 CACAGTAAGTGGGAGGAGAGAGG + Intergenic
1197062287 X:122195717-122195739 CAAGGTCAATGGGATGAGAGGGG + Intergenic
1199297061 X:146171287-146171309 TAACTTTGGTGGGAGCAGAGAGG - Intergenic
1201022418 Y:9673242-9673264 CAACATAAGTGGAAGGAGAGGGG - Intergenic