ID: 1049465857

View in Genome Browser
Species Human (GRCh38)
Location 8:142751019-142751041
Sequence CACAGAAGGCGGGCAGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 472}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049465857_1049465865 -2 Left 1049465857 8:142751019-142751041 CCCGGCCCTGCCCGCCTTCTGTG 0: 1
1: 0
2: 7
3: 50
4: 472
Right 1049465865 8:142751040-142751062 TGCCCACTGACCTATCTCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 176
1049465857_1049465869 10 Left 1049465857 8:142751019-142751041 CCCGGCCCTGCCCGCCTTCTGTG 0: 1
1: 0
2: 7
3: 50
4: 472
Right 1049465869 8:142751052-142751074 TATCTCCCGGGAGTAGAGTGTGG 0: 1
1: 0
2: 2
3: 9
4: 98
1049465857_1049465872 22 Left 1049465857 8:142751019-142751041 CCCGGCCCTGCCCGCCTTCTGTG 0: 1
1: 0
2: 7
3: 50
4: 472
Right 1049465872 8:142751064-142751086 GTAGAGTGTGGTCTTGCACATGG 0: 1
1: 2
2: 1
3: 12
4: 106
1049465857_1049465864 -3 Left 1049465857 8:142751019-142751041 CCCGGCCCTGCCCGCCTTCTGTG 0: 1
1: 0
2: 7
3: 50
4: 472
Right 1049465864 8:142751039-142751061 GTGCCCACTGACCTATCTCCCGG 0: 1
1: 0
2: 1
3: 14
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049465857 Original CRISPR CACAGAAGGCGGGCAGGGCC GGG (reversed) Intronic
900151757 1:1181985-1182007 CACAGAGCTGGGGCAGGGCCAGG + Intronic
900278218 1:1847131-1847153 CACTGAAGGCAGGCAGGGAGAGG + Intronic
900404746 1:2487577-2487599 CACTGCAGGCGGGCAGGCCTTGG - Exonic
900458675 1:2789858-2789880 CGCAGAAGCCGCGCAGAGCCAGG + Intronic
900466078 1:2826089-2826111 GGCAGAAGCCGGGCAGGGCATGG + Intergenic
900625615 1:3607282-3607304 CGCACCAGGCGGGCAGGGGCCGG - Intronic
901396368 1:8985090-8985112 CCCAGAAAGCGGCCAGGGCCAGG - Intergenic
901441214 1:9279665-9279687 CACAGGAGGCGGAAAGTGCCAGG + Intergenic
901460461 1:9388161-9388183 CACAGCTGGCAGGCAGGGACTGG + Intergenic
901615373 1:10535320-10535342 CACATAAGCCGGGCAGGGGATGG - Intronic
902276877 1:15346182-15346204 CACAGGAGGCAGCCAGGGCCAGG - Intronic
902392893 1:16116316-16116338 AAGAGCAGGCCGGCAGGGCCAGG + Intergenic
902413669 1:16226681-16226703 CAGAGATGGTGGGCAGGGCTGGG + Intergenic
902645868 1:17797550-17797572 CTCTGCAGGCGGACAGGGCCAGG + Intronic
903175559 1:21578099-21578121 CCCTGAAGGAGGGCTGGGCCTGG - Exonic
903215194 1:21839782-21839804 CACATAGGGCTGGCAGGGCAGGG - Intronic
903335022 1:22618969-22618991 CAGAGATGGTGGGCAGGGCGGGG - Intergenic
903454655 1:23478955-23478977 CAGAGAAGAGGGGCAGGGCCTGG - Intronic
903561534 1:24231759-24231781 CACAGATGGTGGGGAGGACCTGG - Intergenic
904560738 1:31395514-31395536 GACAGAAGGCGGGGCGGGCGCGG - Intergenic
904641920 1:31937861-31937883 CCCGGAAGGAGGGCCGGGCCGGG - Intronic
904832921 1:33316758-33316780 CCCAGAAGGCAGGCAGGCTCAGG + Intronic
904905447 1:33894407-33894429 CACAGCAGGCTGGAAGGGCTAGG + Intronic
905016414 1:34781662-34781684 CACAGACGGCGGGCACACCCCGG - Exonic
905912917 1:41665980-41666002 CCCAGAAGGCCCACAGGGCCTGG - Intronic
906547252 1:46628544-46628566 CAGAGAAGGCAGTCAGGTCCAGG - Intergenic
906666738 1:47627411-47627433 CCCAGCAAGAGGGCAGGGCCAGG + Intergenic
906919425 1:50048213-50048235 AACAGAGGGCGGGCAGAGTCGGG - Intronic
911651299 1:100391866-100391888 GACAAAAGGTGGGCAGGGCTGGG - Intronic
912457607 1:109808345-109808367 CTCAGCAGGGGGTCAGGGCCTGG + Intergenic
913228861 1:116724364-116724386 ATCTGAAGGCGGGCAGGCCCAGG - Intergenic
915077433 1:153320704-153320726 CACAGAAGGCTGGGAGGTCGAGG - Intergenic
915204873 1:154262652-154262674 CACAGAAGGCAGTAAGGGCTAGG + Intronic
915249438 1:154577850-154577872 CCCAGAAGGGAGGCAGGGCCAGG - Exonic
916075202 1:161196634-161196656 CACAGAAGCTGCGCAGGGTCTGG + Exonic
916758002 1:167791594-167791616 CAGAGAAGAGGGGCTGGGCCTGG + Exonic
917081865 1:171263815-171263837 TATTGAAGGCTGGCAGGGCCTGG + Intronic
917120872 1:171643478-171643500 TGCAGGAGGCTGGCAGGGCCAGG - Intronic
917351309 1:174080950-174080972 CACAGCAGGCAGGGAGGGGCAGG + Intergenic
918071664 1:181137683-181137705 CACAGAAGGAGCCCAGAGCCAGG - Intergenic
919945918 1:202318904-202318926 CAGAGAAGGCTACCAGGGCCTGG - Exonic
920093761 1:203472420-203472442 GACAGAATGCAGGGAGGGCCAGG - Intergenic
920377051 1:205514427-205514449 CCCAGAAAGAGGACAGGGCCAGG + Intronic
920648306 1:207818986-207819008 CAGAGAAGGCGGCCACCGCCCGG - Intergenic
922653240 1:227358865-227358887 CTCAGCAGGCTGGCAGGGTCTGG + Intergenic
923084263 1:230690406-230690428 CAGGGAACGCAGGCAGGGCCTGG - Intronic
923778090 1:236997752-236997774 AAGAGAAGGGGAGCAGGGCCGGG + Intergenic
924156289 1:241180082-241180104 CACAGAAAGTGGGCCGGGCGCGG + Intronic
924415284 1:243850689-243850711 CAGAGGCGGCGGGCAGGGCCGGG - Intronic
924855903 1:247874817-247874839 CACAGAAGCCTGGCCTGGCCTGG - Intronic
924932586 1:248743873-248743895 GACAGAAGGAGCGCATGGCCTGG + Intronic
1064155375 10:12899015-12899037 CACAGAAGGTGGACAGTTCCGGG + Intronic
1068520632 10:58073461-58073483 CTCAGAAGGAGGGAGGGGCCAGG - Intergenic
1068786709 10:60983828-60983850 GCCAGAAGGAGGGCGGGGCCGGG - Intronic
1069792229 10:71030072-71030094 CCCTGAAGGCAGGCAGGGCCAGG - Intergenic
1072619996 10:97073501-97073523 TTCAGAAGGAGGGCAGGGGCAGG + Intronic
1073550255 10:104393542-104393564 CACTGAAGGCAGCCAGGGGCAGG + Intronic
1075333665 10:121593739-121593761 AACTGAAGGAGGGCCGGGCCAGG + Exonic
1075409856 10:122219306-122219328 CACTGAAGGCGGGCAGAGCCAGG - Intronic
1075441609 10:122484320-122484342 TACAGAAGGGAGACAGGGCCAGG - Intronic
1075778120 10:125001031-125001053 CACAGAAGACGACCAGGACCAGG - Intronic
1076023366 10:127092383-127092405 CACAGAGGGCGGCCAGTGCCAGG - Intronic
1076290842 10:129344278-129344300 CCCAGAAGTCGGGAAAGGCCGGG + Intergenic
1076297956 10:129402214-129402236 CACACCAGGCTGGCAGGGTCAGG + Intergenic
1076405129 10:130206626-130206648 AGCACAAGGCAGGCAGGGCCAGG - Intergenic
1076765942 10:132633131-132633153 CACAAAAGGCAGCCAGGGACAGG - Intronic
1076776484 10:132700641-132700663 CACAGAGGGAGGGGCGGGCCCGG - Intronic
1076902348 10:133346133-133346155 TAAAGAAGGTGGTCAGGGCCGGG + Intronic
1077048182 11:555340-555362 CGCAGAGGCCGGGCTGGGCCTGG - Exonic
1077056995 11:598640-598662 CACAGAAGCCGCGCCGGGCCCGG + Intronic
1077143237 11:1034010-1034032 CCCAGAAAGTGGGCAGAGCCTGG - Intronic
1077226051 11:1439593-1439615 CCCAGGAGGTGGGCATGGCCGGG + Intronic
1077270902 11:1679974-1679996 CTGAGAAGGCTGCCAGGGCCCGG - Intergenic
1077402552 11:2366349-2366371 CACCCCAGGCGGGCAGAGCCAGG - Intergenic
1077407734 11:2390179-2390201 CACAGGTGCAGGGCAGGGCCAGG + Intronic
1077462431 11:2717326-2717348 CACAGAAGCCTGGGAGGGCCTGG - Intronic
1077580255 11:3412982-3413004 CACAGGAGGCTGGCCGGGCGCGG - Intergenic
1077606763 11:3617525-3617547 CACAGAAAGAGGACAAGGCCTGG + Intergenic
1077826892 11:5820527-5820549 CAGTGAAGGAGAGCAGGGCCAGG - Exonic
1078090153 11:8260027-8260049 CACAGGAGAAGGGCAGGGCTGGG - Intronic
1078415049 11:11157942-11157964 CTCAGCTGGCGAGCAGGGCCTGG + Intergenic
1079095888 11:17509803-17509825 CACAGAAGGCGGGGGAGGCGGGG + Exonic
1079591874 11:22192441-22192463 CCCAGGAAGCAGGCAGGGCCAGG + Intergenic
1079610764 11:22430083-22430105 CACAGAAGGTGGGAAAGGCAGGG + Intergenic
1079714813 11:23731733-23731755 CACAGAAGGCGAGCAGAAGCAGG + Intergenic
1080771555 11:35346804-35346826 CAGAGAAGAGGGGCAGGGCAGGG + Intronic
1081352029 11:42066021-42066043 CACAGAAGTGGGGAAGGGCGTGG + Intergenic
1082068455 11:47919502-47919524 CAGAAAAGAAGGGCAGGGCCTGG - Intergenic
1083487519 11:62993004-62993026 GACAGAAGAATGGCAGGGCCTGG + Exonic
1083674112 11:64316060-64316082 CACAGCCTGCTGGCAGGGCCAGG + Exonic
1083751526 11:64763566-64763588 GGCAGAATGGGGGCAGGGCCTGG - Intergenic
1083901471 11:65645555-65645577 CTCAGAGGGAGGGCAGGGTCAGG - Intronic
1084320903 11:68372900-68372922 GTCAGGAGGGGGGCAGGGCCTGG + Intronic
1084492516 11:69486544-69486566 CAGAGAAGACACGCAGGGCCAGG + Intergenic
1084548239 11:69825208-69825230 CAGAGGCGGCGGGCAGTGCCTGG + Intergenic
1084835228 11:71797020-71797042 CACAGGAGGCTGGCCGGGCGCGG + Intronic
1084971375 11:72774081-72774103 CAAAGACGGCAGGCAGGGGCAGG + Intronic
1085085374 11:73663099-73663121 CTCAGAAAGCAGGCAGGACCTGG - Intergenic
1085514805 11:77105910-77105932 CACAGAGGGCGTGGAGGGGCTGG + Intronic
1085644982 11:78217044-78217066 CAGAGGAGGAGGGCAGGGCTTGG - Exonic
1086362059 11:86069360-86069382 CACAGACGCCGGGCGGGGCGGGG + Intronic
1087814276 11:102641263-102641285 CAGAGGAGGCTGGCGGGGCCAGG + Intergenic
1088889276 11:114032004-114032026 CCCAGCAGGCTGCCAGGGCCAGG - Intergenic
1089026320 11:115274321-115274343 CACAGTGTGCGGGCAGAGCCTGG - Intronic
1089713784 11:120336691-120336713 CACAGAAGGAGCCCCGGGCCCGG + Intergenic
1090056833 11:123430975-123430997 CCAAGACGGCGGGCAGGTCCCGG - Exonic
1090312409 11:125753224-125753246 AACAGAAGGCAGGCAGGGCGCGG + Intergenic
1090639818 11:128720850-128720872 CAGAGAAGGCGCAGAGGGCCTGG - Intronic
1090720324 11:129466889-129466911 CACAGAGGGCGGGCAGAAGCAGG + Intergenic
1091044260 11:132311911-132311933 GAGAGCAGGCTGGCAGGGCCAGG + Intronic
1091285659 11:134407324-134407346 CAGAGAGGACGGGCAGAGCCAGG + Intronic
1091368163 11:135038855-135038877 TCCTGAAGGCAGGCAGGGCCAGG + Intergenic
1091448829 12:560229-560251 CACAGGAGGTGGACAGGGCAAGG + Intronic
1091601078 12:1918135-1918157 CCCAGAGGGAGGGCAGGGGCGGG + Intronic
1092125402 12:6071870-6071892 GACAGAAGCCAGGCTGGGCCTGG + Intronic
1092163024 12:6326522-6326544 CAGGGAAGGCGTGGAGGGCCTGG - Exonic
1092235781 12:6808100-6808122 AAAAGCAGGCAGGCAGGGCCAGG + Intronic
1092407838 12:8233400-8233422 CACAGGAGGCTGGCTGGGCGTGG - Intergenic
1093478266 12:19578981-19579003 TACAGAAGGCTGGCCGGGCATGG + Intronic
1096413068 12:51391210-51391232 CACAGAAGGAATGCAGGGCATGG + Intronic
1096670240 12:53194156-53194178 GGCAGAAGGCGGGCAGGGGGAGG - Exonic
1097854811 12:64451733-64451755 CACAGACGGCCGGCAGAGCTGGG - Intergenic
1102031757 12:109743831-109743853 CCCAGATGCCGAGCAGGGCCGGG + Intronic
1102926871 12:116833322-116833344 CACAGAATGCAGGTAAGGCCAGG - Intronic
1102968681 12:117148755-117148777 GACAGCAGGCGGGGAGGGGCTGG + Intronic
1103609884 12:122116816-122116838 TGCAGAAGGTGGGCTGGGCCGGG + Intronic
1103917630 12:124384207-124384229 CGCAGAAGGGGGCCTGGGCCGGG - Intronic
1104788119 12:131464214-131464236 CACTGAAGGCAGGCAGGGAGAGG + Intergenic
1105026613 12:132853331-132853353 GACAGGAGGCGGGCAGAGCGCGG + Intronic
1105344314 13:19559897-19559919 CACAGCCTGCTGGCAGGGCCAGG - Intergenic
1105535720 13:21261677-21261699 CACAGCCTGCTGGCAGGGCCAGG + Intergenic
1107642045 13:42453462-42453484 CACGGAGGGCGAGCAGGACCAGG - Intergenic
1107880656 13:44829447-44829469 CACAGTAGGAGGGAAGGCCCAGG - Intergenic
1111429517 13:88133499-88133521 CACAGAAGACGGCCACGCCCGGG + Intergenic
1112989038 13:105488192-105488214 CACAGAAGGCAGGCAGGTTGGGG - Intronic
1113695416 13:112342610-112342632 CACAGGAGGCTGGAAGGGGCAGG + Intergenic
1113856056 13:113446040-113446062 CAGAGAGAGCGTGCAGGGCCCGG + Intronic
1113868316 13:113543308-113543330 CACAGAGGGAGGGCGGGGGCAGG - Intronic
1113889591 13:113728874-113728896 CACAAAAGGTGGACAAGGCCCGG + Intronic
1113902708 13:113805550-113805572 CACAGAAGGCGGTCATGCCCAGG - Intronic
1113957192 13:114105183-114105205 CCCAGGAGGAGGGCAGGTCCGGG + Intronic
1114222739 14:20711536-20711558 CACAGAAGGAGGACAACGCCAGG - Intergenic
1114252133 14:20970879-20970901 TGCAGAAGGAGGGCAGGGCGAGG - Intergenic
1114523968 14:23356706-23356728 CACAGAAGGCGGAGAGAGCTGGG - Exonic
1114533700 14:23410337-23410359 CGGAGCAGACGGGCAGGGCCTGG - Intergenic
1114740520 14:25092268-25092290 CCCAGAAGGAGGCCATGGCCTGG + Intergenic
1114741670 14:25104407-25104429 CACAGAGGGCGGGCAGAAGCAGG + Intergenic
1115001121 14:28420763-28420785 CACAGAGGGCTGGCAGGGTGAGG + Intergenic
1117136228 14:52736845-52736867 AAGAGAAGGTGGGCAGGGACTGG - Intronic
1118615437 14:67571906-67571928 CAGAGAAGGGGAGCAGGGGCAGG + Intronic
1118765519 14:68906980-68907002 AACAGAAGGGGGGCTGGGCGCGG + Intronic
1119719469 14:76881524-76881546 CCCAGTAGGCTGGCAGTGCCTGG + Intergenic
1121052922 14:90831120-90831142 TCCAGAAGGCGGGCAGGGGCTGG + Intergenic
1121194611 14:92058733-92058755 CACAGAAGGGCTGCAGGGCTGGG + Exonic
1121258426 14:92549021-92549043 CACAGAGGGAGTGCAGGGGCCGG - Intronic
1121439327 14:93939021-93939043 CATGGGAGGCGGGCGGGGCCGGG - Intronic
1122072557 14:99213991-99214013 CACAGAGGGCAGGCAGAACCTGG + Intronic
1122110680 14:99498879-99498901 GACAGAGGGAGGGCAGGCCCTGG + Intronic
1122634349 14:103123236-103123258 CCCAGCAGCCGGGCAGGGGCGGG - Intergenic
1122721299 14:103724030-103724052 CAGAGAAGGGGTGCAGGGCAGGG + Intronic
1122882273 14:104695478-104695500 CACTGAGGGTGTGCAGGGCCTGG - Intronic
1122941134 14:104981887-104981909 TTCAGCTGGCGGGCAGGGCCCGG - Intergenic
1202930290 14_KI270725v1_random:28795-28817 CCCAAAGGGAGGGCAGGGCCAGG - Intergenic
1123422094 15:20142722-20142744 GACAAAGGGAGGGCAGGGCCAGG + Intergenic
1123467964 15:20530113-20530135 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1123531322 15:21149262-21149284 GACAAAGGGAGGGCAGGGCCAGG + Intergenic
1123650149 15:22470929-22470951 AACAGAAGGTGGGCAGGGCGGGG - Intergenic
1123728277 15:23125322-23125344 AATAGAAGGTGGGCAGGGCAGGG + Intergenic
1123740555 15:23279771-23279793 AACAGAAGGTGGGCAGGGCGGGG - Intergenic
1123746443 15:23322787-23322809 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1124278710 15:28346104-28346126 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1124303989 15:28565504-28565526 AATAGAAGGTGGGCAGGGCGGGG - Intergenic
1124532870 15:30521979-30522001 AATAGAAGGTGGGCAGGGCGGGG - Intergenic
1124707188 15:31975860-31975882 CACACTAGGCATGCAGGGCCAGG - Intergenic
1124765786 15:32485665-32485687 AACAGAAGGTGGGCAGGGCGGGG + Intergenic
1125721721 15:41848349-41848371 CAGAGCAGGTGGGCAAGGCCAGG - Exonic
1126373534 15:47971716-47971738 CACCGAAGTAGGGCAGGGCAGGG + Intergenic
1127654756 15:61045660-61045682 CAGAGAATGAGGGCAGGCCCTGG + Intronic
1129270049 15:74414792-74414814 GGCAGAAGGAGGGCTGGGCCTGG + Intronic
1129298323 15:74611743-74611765 CAGAGACAGCGGGCAGGGCTGGG + Intronic
1129969178 15:79762239-79762261 CACAGAAGACGGCCACGCCCAGG + Intergenic
1129997170 15:80016748-80016770 CACGGAGGGCGGGCAGGCTCAGG - Intergenic
1130657610 15:85802888-85802910 CCAACAAGGCGGGAAGGGCCAGG + Intergenic
1132050115 15:98600603-98600625 GACAGAGAGCAGGCAGGGCCAGG - Intergenic
1132079283 15:98851236-98851258 CATGCCAGGCGGGCAGGGCCGGG + Intronic
1132513420 16:354756-354778 CAGAGCAGGTGGGCAGGGGCTGG + Intergenic
1132689716 16:1177038-1177060 CAGAGAAGGTGCGGAGGGCCTGG - Intronic
1132882845 16:2170095-2170117 CTCAGAGGGAAGGCAGGGCCAGG - Intronic
1133236271 16:4388742-4388764 CACAGAGGGTGGGAAGGGCTGGG + Intronic
1133977443 16:10609406-10609428 CACAGAAGGCAGGCAGGGTCCGG + Intergenic
1134027285 16:10964011-10964033 CACTTCTGGCGGGCAGGGCCCGG - Intronic
1134190782 16:12119684-12119706 CCCAGGAGCCGGGCTGGGCCTGG + Intronic
1134672009 16:16062790-16062812 CACAGAGGCCGGGGAAGGCCAGG + Intronic
1135918438 16:26626410-26626432 CTCAGGAGCTGGGCAGGGCCAGG + Intergenic
1136228914 16:28875858-28875880 CCCTGAAGGCTGGCAGGGCTGGG - Intergenic
1136513048 16:30750883-30750905 CAGGGAAGGCAGGTAGGGCCTGG - Intronic
1136656497 16:31712349-31712371 CCCAGAAGGCGTGCAGTGCCGGG + Intergenic
1136656852 16:31714436-31714458 CCCAGAAGGCGTGCAGTGCCAGG + Intronic
1137982835 16:53084452-53084474 CACAGAAGCCTGGCAGGGTGCGG + Intronic
1138084214 16:54119031-54119053 CACAGCAGGCTGCCAGGGCTTGG + Exonic
1138925021 16:61580796-61580818 CACACAGGGCGGGCAGCTCCAGG + Intergenic
1139361835 16:66404291-66404313 CACAGAGGTTGGGCAGGGCAGGG - Exonic
1139476083 16:67203221-67203243 AACGTAAGGCGGGCAGGGGCGGG + Exonic
1140427744 16:74875034-74875056 CCCCGACGGCTGGCAGGGCCTGG + Intronic
1141172873 16:81702160-81702182 CACAGAAGGACGGAAGGGGCAGG + Intronic
1141594140 16:85087188-85087210 GGCAGGAGGCGGGCAGGGCTGGG + Intronic
1142032601 16:87845981-87846003 CACAGAAGAATGGCAGGCCCAGG + Intronic
1142197668 16:88746211-88746233 TACACAAGGCTGGCAGAGCCGGG + Intronic
1142244640 16:88964283-88964305 AACAGGAGGCAGGCAGGGCATGG - Intronic
1142259082 16:89034013-89034035 CACAGCACACGGGCAGGGCTGGG + Intergenic
1142336701 16:89493989-89494011 CAGAGAGGCCGGGGAGGGCCAGG + Intronic
1143571827 17:7764050-7764072 CACAGGAAGGGGGCAGGGGCAGG + Intronic
1143575205 17:7788257-7788279 CACAGACCACGGGCAGGGGCAGG + Intronic
1143647604 17:8241322-8241344 CACAAAAAGCAGGCAGGGGCTGG + Intronic
1144581908 17:16463909-16463931 GACAGATGGCGGGCAGGGACGGG + Intronic
1144758523 17:17694449-17694471 CTCAGAGGGCTGGGAGGGCCCGG + Intronic
1144891057 17:18494611-18494633 CCCAGAAGGCGGGCACAGCCAGG + Exonic
1144938373 17:18918368-18918390 CACATAAGGCAGGCAGTGCTGGG - Intronic
1145141166 17:20449707-20449729 CCCAGAAGGCGGGCACAGCCAGG - Intronic
1145254359 17:21314544-21314566 CACAGCAGGCTGCCAGTGCCTGG + Exonic
1146275402 17:31512852-31512874 CACAGCAGGCGGGAATGGGCAGG + Intronic
1147164359 17:38585580-38585602 CACACAAGGAAGGCAGAGCCAGG - Intronic
1148359938 17:47003420-47003442 CACAACAGGGGGGCAGGGCTGGG + Intronic
1148704505 17:49617631-49617653 TACAGAAGGCTGGCTGGGCGTGG + Intronic
1150060549 17:62065282-62065304 CACAGACACCGGGGAGGGCCGGG + Exonic
1150266938 17:63837999-63838021 AAGAGAAGGAGGGCAGGGCTTGG - Intronic
1151714248 17:75823423-75823445 CGGAGAAGGCGGGCAGGGCCTGG - Exonic
1152091820 17:78251412-78251434 GACAGAAGGAGGGCAGGTCTTGG + Intergenic
1152199952 17:78939528-78939550 AACAGAAGGCAGTCAGGGGCTGG + Intergenic
1152425441 17:80216036-80216058 CACAAAAGGGGGGCCGGGCTCGG + Intronic
1152556399 17:81055270-81055292 CTGAGAAGGAGGGCAGTGCCAGG - Intronic
1152654224 17:81512605-81512627 AACAAAAGGCGGGGTGGGCCGGG - Exonic
1152681265 17:81669484-81669506 CACAGGAGGCGGACAGTGCCAGG - Intronic
1152830898 17:82496575-82496597 CACGGAAGGAGGGCACGCCCAGG + Intergenic
1152855572 17:82663312-82663334 CCCAGCAGGCAGGAAGGGCCAGG + Intronic
1153051385 18:905785-905807 CACAGGATGGGGGCAGGGCACGG + Intronic
1155086387 18:22463313-22463335 CAGAAAAGGAGGGCAGAGCCTGG - Intergenic
1158320074 18:56252642-56252664 CAGAAAAGGTTGGCAGGGCCAGG + Intergenic
1158326947 18:56322677-56322699 CACAAATGGGGAGCAGGGCCCGG - Intergenic
1160470133 18:79124465-79124487 CAAAGAAGGCAGGCATGGCACGG - Intronic
1160809759 19:1008285-1008307 TACAGAGGTGGGGCAGGGCCTGG + Exonic
1161461431 19:4400132-4400154 CCCGCATGGCGGGCAGGGCCTGG + Intronic
1161672932 19:5624091-5624113 CCCGGGAGGCGGGCAGAGCCTGG + Intronic
1162485845 19:10960432-10960454 CAGAGAAGGCGGCCACGGTCGGG + Intergenic
1162683784 19:12365388-12365410 GACTGAAGGCCGGCTGGGCCAGG + Intronic
1162934823 19:13976702-13976724 CACAGAAAGCGGGTAGAGGCTGG + Intronic
1163008495 19:14410689-14410711 CACTGAGGGCAGGCGGGGCCTGG + Intronic
1163250600 19:16124435-16124457 CACAGATGCAGGGCTGGGCCTGG + Intronic
1164250481 19:23470858-23470880 GAAAGAAGGGGGCCAGGGCCTGG + Intergenic
1164623349 19:29710757-29710779 CAAAGGAGCTGGGCAGGGCCTGG - Intronic
1165073959 19:33270494-33270516 GCCAGATGGTGGGCAGGGCCTGG - Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165827016 19:38711354-38711376 CTCAGAAGGTGAGCTGGGCCAGG + Intronic
1166227976 19:41408901-41408923 GACAGAAGGAGCTCAGGGCCTGG - Intronic
1167037378 19:47002278-47002300 CACTGCAGGCGGGCACGGGCAGG - Exonic
1167245770 19:48372348-48372370 CATAGAAGACAGGCATGGCCGGG + Intronic
1167323882 19:48812506-48812528 CCCAGGGGGGGGGCAGGGCCCGG - Intergenic
1167506097 19:49871836-49871858 CACAGAAGGGGGGAAGGTCCTGG + Exonic
1167595845 19:50427804-50427826 CACAGAACGCGGAGGGGGCCTGG + Intronic
1167672099 19:50859303-50859325 GACAGAAGCAGGACAGGGCCTGG + Intronic
1167674853 19:50877729-50877751 GACAGAAGAAGGACAGGGCCTGG + Intronic
1168213915 19:54911459-54911481 AATAGAAGACGGGCTGGGCCGGG + Intronic
1168335246 19:55593496-55593518 CACTCAAGGCGGGCAGGCCAGGG + Exonic
1168350598 19:55673837-55673859 CACTGAAGGCAGGAAGGGACAGG - Intronic
925466425 2:4110728-4110750 CACGGAAGGAGGGCAGGGAATGG - Intergenic
926153254 2:10436056-10436078 CACAGCAGGAATGCAGGGCCAGG + Intergenic
927518229 2:23684368-23684390 CAGAGAAGACAGACAGGGCCAGG - Intronic
927519696 2:23691282-23691304 CACCCAAGGCAGGCAGGGCCGGG + Intronic
927707165 2:25303524-25303546 CAGAGAGGGCGGGGAGTGCCAGG + Intronic
927981778 2:27378898-27378920 CACAGCTGGCAGGCTGGGCCTGG + Exonic
928097545 2:28413673-28413695 CACAGAGGGCAGGAAAGGCCCGG - Exonic
928433875 2:31241197-31241219 GGCAGGAGGCAGGCAGGGCCAGG - Intronic
928576980 2:32665135-32665157 CACAGAATGTGGGCTGGGCGTGG - Intronic
929605718 2:43232820-43232842 CACACAGGACGGCCAGGGCCAGG + Exonic
929819194 2:45259743-45259765 AAGGGAAGGTGGGCAGGGCCAGG + Intergenic
931443823 2:62310038-62310060 CACAAATGGCTGGCAGGGCGGGG + Intergenic
931649236 2:64454001-64454023 GCCAGAGGGTGGGCAGGGCCGGG - Intronic
932128264 2:69164687-69164709 CATACAAGGCTGGCACGGCCTGG - Intronic
932429633 2:71666377-71666399 CTCAGAAGGCACACAGGGCCAGG - Intronic
932620851 2:73264252-73264274 CACAGAAGGCAGGCAGGGGCAGG + Intronic
934737174 2:96695477-96695499 CAAAGAAGGAGGGCAGGACAAGG - Intergenic
934783240 2:96986309-96986331 CACATAGGGCGGGAAGGGCAGGG + Exonic
935681579 2:105642821-105642843 GACAGCAGGCGGTCAGGCCCGGG + Intergenic
936172680 2:110190322-110190344 CACAGAGGGCGGGGAGGCTCAGG + Intronic
936638220 2:114283405-114283427 CACATAAGGAGGGCAGGGGCAGG - Intergenic
937409132 2:121657500-121657522 CACAGAACGCAGGCTGGGCATGG - Intergenic
937823154 2:126334687-126334709 CCCAGAAGTCTGTCAGGGCCTGG - Intergenic
938408844 2:131047404-131047426 CGCCTAAGGCGAGCAGGGCCAGG + Intergenic
941905181 2:170713058-170713080 CCAGGGAGGCGGGCAGGGCCGGG - Exonic
942485784 2:176438554-176438576 CACAGATGTGGGGCAGGACCTGG + Intergenic
943237998 2:185347573-185347595 CACAGCAGGCTGGTAGGGGCTGG - Intergenic
943569767 2:189559580-189559602 CACAGAAGTAGGGCAGGGGTAGG - Intergenic
944356946 2:198801532-198801554 CTCAGAAGTGGGGCAGGGCAAGG - Intergenic
944464042 2:199982654-199982676 CACAGGAGCCGGGCAAGCCCAGG + Intronic
945554473 2:211262231-211262253 CACAGAATGAGGGCAAGGACAGG - Intergenic
946050005 2:216854706-216854728 CAGAGCAGGCGGGCACCGCCAGG + Intergenic
946805340 2:223465517-223465539 CACATAACAAGGGCAGGGCCAGG + Intergenic
947678448 2:232007089-232007111 GGCAGAAGGGGAGCAGGGCCAGG + Intronic
948610614 2:239163997-239164019 CACAGAGGGAGGGAAGGGCTGGG + Intronic
948622636 2:239246182-239246204 CTCAGCAGGCAGGCAGAGCCCGG + Intronic
948884540 2:240876165-240876187 CACTGGCTGCGGGCAGGGCCAGG + Intronic
1168757601 20:327248-327270 CAGAGAAGGCGGGCCGGGCGAGG - Exonic
1169117685 20:3076369-3076391 CACAGAGGGCTGGCTGGGCAAGG + Intergenic
1169209530 20:3758474-3758496 CCCAGAAGCCAGGCAGAGCCGGG + Intronic
1169421412 20:5463667-5463689 CACAGAAGGCGAGCAGAAGCAGG - Intergenic
1170011032 20:11724155-11724177 CACAGCAGGCTGGAAGTGCCAGG - Intergenic
1170577499 20:17675532-17675554 CAGAGAAGGGGGGCAGGGAGTGG + Intronic
1172144835 20:32749653-32749675 GTTGGAAGGCGGGCAGGGCCTGG - Intergenic
1173473507 20:43341634-43341656 GGCAGAAGCCAGGCAGGGCCAGG + Intergenic
1174295191 20:49540571-49540593 CCGAGAAGGAGGTCAGGGCCTGG + Intronic
1175101321 20:56580578-56580600 CGCAGAAGGCAGGCTGGACCTGG + Intergenic
1175250791 20:57609191-57609213 CACGCAAGGTGGGGAGGGCCAGG - Intronic
1175847044 20:62064881-62064903 CCCAGAACGGGGGCAGCGCCGGG - Exonic
1176217406 20:63954820-63954842 CACAGACGGTGGGCTGGGCACGG - Intronic
1176592302 21:8657377-8657399 CCCAAAGGGAGGGCAGGGCCAGG - Intergenic
1177703806 21:24674321-24674343 CACAGGATGGGGGCAGGGCAGGG - Intergenic
1178007033 21:28233889-28233911 CACAGAAGGCGAGCAGAAGCAGG + Intergenic
1179102428 21:38365909-38365931 CACAGAGGGCTTACAGGGCCTGG + Intergenic
1179162950 21:38912893-38912915 TGCAGACGGCGGGGAGGGCCTGG + Intergenic
1179375841 21:40849092-40849114 CTCAGCAGGCTGGCAGTGCCAGG - Intergenic
1179380498 21:40894786-40894808 CACAGAAGGTGGCCAGGCCAGGG - Intergenic
1180045277 21:45302336-45302358 CACAGAAGCCAGGAAGGGGCGGG + Intergenic
1180061741 21:45388756-45388778 CCCAGCAGGAAGGCAGGGCCAGG + Intergenic
1180135857 21:45861303-45861325 CAGAACAGGCAGGCAGGGCCTGG - Intronic
1180184261 21:46131683-46131705 CTCAGCAGGTGGACAGGGCCTGG + Intronic
1180275153 22:10634506-10634528 CCCAAAGGGAGGGCAGGGCCAGG - Intergenic
1180593736 22:16960790-16960812 CAGGGAAGGAGGGCAGGGCCAGG - Intergenic
1180880132 22:19197703-19197725 GACAGCAGGATGGCAGGGCCAGG - Intronic
1181309754 22:21938242-21938264 CCCATCAGGCGGGGAGGGCCTGG + Intronic
1181387916 22:22558386-22558408 GACAGAAGGCGGGCCAGGGCGGG + Intronic
1181963042 22:26636855-26636877 CCCAGAATGAGGGCTGGGCCTGG + Intergenic
1182319093 22:29466630-29466652 GACAGAAGGAGGGAAGGCCCAGG + Intergenic
1182520995 22:30884539-30884561 CACACAGGGTGGGCAGGGCAAGG - Intronic
1182558865 22:31143399-31143421 CACAGAAAAGGGCCAGGGCCAGG + Intergenic
1182650671 22:31848582-31848604 CACAGCAGGAGGCCAGGCCCAGG + Intronic
1183063565 22:35349407-35349429 CACAGAAGGCCCCCAGGGCTGGG + Intergenic
1183082821 22:35467780-35467802 GGCAGAAGGAGGGCAGGGTCGGG + Intergenic
1183675809 22:39298278-39298300 CAGAGAAGGCAGGAAGGGACAGG + Intergenic
1184356215 22:43981142-43981164 CACCGAAGGCGAGCAGGGCCCGG - Intronic
1184468680 22:44683563-44683585 CCCCGAAGGAGGGCAGGGGCTGG + Intronic
1184663364 22:45975731-45975753 CACAGTAGGCGCGCAGGGCGCGG + Intronic
1184831937 22:46994340-46994362 CACAGCAGGTGGGCAGGGCCCGG - Intronic
1184943981 22:47788033-47788055 CACTGGAGCTGGGCAGGGCCGGG + Intergenic
1185070534 22:48653396-48653418 CCCAGCAGGTGGGCAGGGCAGGG + Intronic
1185079206 22:48700419-48700441 CAGAGCAGGCCGGCAGGGGCTGG + Intronic
1185366019 22:50437098-50437120 CACAGGTGCCGGGAAGGGCCCGG - Intronic
1185368354 22:50447115-50447137 CAGAGCAGCCGGGCAGGGCTGGG + Exonic
1185385116 22:50528293-50528315 CACAGATGGCTGGCGGGGCACGG - Intronic
949098174 3:111572-111594 CATAGAAGGAGGGCAGGGGAAGG + Intergenic
949371303 3:3337455-3337477 CACAGAAGGCTTGAAGGGACAGG + Intergenic
950169023 3:10823498-10823520 CACAGAAGCCAGGAAGTGCCAGG - Intronic
950206401 3:11084462-11084484 GACAGAAGGCTGCCTGGGCCTGG - Intergenic
953339754 3:42123450-42123472 CACAGGAAGCAGGAAGGGCCAGG - Intronic
953912227 3:46898937-46898959 GGCAGGAGGCGGGCAGGGCGAGG - Intronic
953982776 3:47420892-47420914 CTGAGGAGGCGGGCAGGGCAGGG + Intronic
954384250 3:50236154-50236176 CACCGACGGCGGGGCGGGCCGGG - Exonic
954401150 3:50320473-50320495 CCCAGCATGCGGGCAGGCCCAGG - Exonic
954611016 3:51944589-51944611 CAAGGAAGGTGGGCAGGCCCTGG + Intronic
954831305 3:53423554-53423576 AACAGAAGGCAAGCAGGGCAGGG - Intergenic
955960853 3:64340071-64340093 TACAGAAGTGGGGCTGGGCCAGG - Intronic
956444592 3:69313493-69313515 GACAGAAGGCAGGCACTGCCAGG - Exonic
956964521 3:74443458-74443480 CACTGAAGGAGGGGAGGGGCAGG - Intronic
957053124 3:75425580-75425602 CACAGGAGGCTGGCCGGGCGCGG - Intergenic
959668245 3:108944980-108945002 CACAGGATGAGTGCAGGGCCAGG + Intronic
960280428 3:115775261-115775283 CTCACAAGGCAGACAGGGCCAGG - Intergenic
961301708 3:125925965-125925987 CACAGGAGGCTGGCCGGGCGCGG + Intergenic
961522044 3:127472635-127472657 CACAGGAGGAGGGCAGGGCAGGG - Intergenic
961529097 3:127528954-127528976 CTCAGAGGGTGGGCAGGGTCTGG - Intergenic
961550799 3:127669676-127669698 CGCAGCAGGAGCGCAGGGCCTGG - Intronic
962655666 3:137542100-137542122 CACAGAACAGGGGAAGGGCCAGG + Intergenic
962804298 3:138915898-138915920 CACAGGAGGAGGCGAGGGCCGGG + Intergenic
963604652 3:147404287-147404309 CACAAAAGGCTGACAGGACCTGG - Intronic
965681724 3:171258702-171258724 GGCAGAAGGAGGGCAGGTCCTGG - Intronic
966607163 3:181832909-181832931 CTCAGAAGGCGGGCAGGAAGAGG - Intergenic
966643274 3:182214469-182214491 CACAGAAAGGGTGCAGGGCTGGG + Intergenic
966874658 3:184315134-184315156 CCCGGAGGGCGGGCGGGGCCGGG - Intronic
967596187 3:191329171-191329193 CGTAGGAGGGGGGCAGGGCCCGG + Exonic
968441502 4:626731-626753 CACTGAAGGAGGGAAGGGCAGGG + Intronic
968478446 4:823722-823744 ACCAGGAGGTGGGCAGGGCCTGG - Intronic
968578359 4:1378250-1378272 CACAGAGGGCTGGCGGGCCCTGG + Intronic
969060648 4:4431704-4431726 CACAGAAGGTGGGCAGGCTGGGG - Intronic
969538517 4:7771227-7771249 CACAGAATGTGGGCTGGGCATGG + Intronic
969588007 4:8105665-8105687 CGCAGAAGGCAGGCAGGCACGGG + Intronic
969728331 4:8938978-8939000 CACAGATGGAAGGCAGGGCCCGG + Intergenic
969758061 4:9162807-9162829 CACAGGAGGCTGGCTGGGCACGG + Intergenic
969818036 4:9700349-9700371 CACAGGAGGCTGGCTGGGCGCGG + Intergenic
973220782 4:47723701-47723723 CAAAGAAGCAGGGCAAGGCCAGG + Intronic
973606636 4:52593602-52593624 CCCAGAAGGAGGGCAGGCACAGG - Exonic
973774107 4:54229999-54230021 CGCAGGAGGCGGGCTGGGCTCGG + Intronic
974671466 4:65035711-65035733 CACAGAAGATGGTCAGGACCCGG + Intergenic
975046192 4:69807551-69807573 CACAGTAGGGGGGCCTGGCCTGG - Intergenic
976928651 4:90534423-90534445 CACAAAAGGCTGGCACAGCCTGG - Intronic
978126773 4:105145876-105145898 AACAGAAGGTGGGCCGGGGCGGG + Intronic
983485987 4:168331649-168331671 CACAGAAGGCGAGCAGAAGCAGG - Intergenic
984212931 4:176873076-176873098 CAGAGAAGGCGGGGAAGGCAGGG - Intergenic
984814713 4:183825599-183825621 CACAGAGGACGGGCAGGGAGGGG - Intergenic
985207836 4:187559508-187559530 CACAGTCAGAGGGCAGGGCCTGG - Intergenic
985240200 4:187923006-187923028 GTCAGAAGTCTGGCAGGGCCTGG + Intergenic
985480895 5:109558-109580 CACAGAAGCTGGGCTGGGCTGGG + Intergenic
985860921 5:2470170-2470192 CATGCCAGGCGGGCAGGGCCAGG - Intergenic
986175361 5:5347958-5347980 CAGAGAAGGAGGACAAGGCCAGG + Intergenic
987133811 5:14882690-14882712 GACAGCAGGCAGGCAGGGGCAGG + Intergenic
987179154 5:15348252-15348274 CACTGAAGGCGGGCAGAGGTGGG - Intergenic
988145408 5:27299701-27299723 CACAGAAGTGGGGCAGTGGCAGG - Intergenic
989404208 5:41042369-41042391 CACAGATGGAGGGCAGAGCCTGG - Intronic
989687783 5:44109864-44109886 CACAGGATGCGGGGAGGGTCAGG - Intergenic
990376202 5:55173314-55173336 CAGAGAGGGCCGGCAGGGGCGGG - Intergenic
990742082 5:58922630-58922652 CCTCGTAGGCGGGCAGGGCCTGG - Intergenic
991670080 5:69038403-69038425 CACAGATGGGGGGCAGGGGGTGG + Intergenic
992554762 5:77892433-77892455 CACAGAAGCCGGGCAGGGGAAGG - Intergenic
994355891 5:98793402-98793424 CATCGATGACGGGCAGGGCCAGG + Exonic
997356090 5:133263913-133263935 GACAGAAGGTGGGCAGAGCCTGG + Intronic
997470482 5:134114641-134114663 CACTGGGGGCGGGCCGGGCCGGG - Intergenic
997625248 5:135326920-135326942 CACAGAGGCTGGCCAGGGCCCGG + Intronic
997934094 5:138095752-138095774 CACTGAAGGCAAGCAGAGCCTGG + Intergenic
998204521 5:140149303-140149325 CTCAGAAGAATGGCAGGGCCTGG + Intergenic
998507163 5:142681348-142681370 CACAGCAAGCGTGCTGGGCCAGG - Intronic
999311081 5:150552652-150552674 AACCCAAGGCGGGCAGGGCCAGG - Intronic
999657937 5:153828861-153828883 CTCAGAGGGTAGGCAGGGCCAGG - Intergenic
1001087609 5:168712429-168712451 AACTGAAGGGTGGCAGGGCCAGG - Intronic
1001311425 5:170613623-170613645 AAAAGGAGGCGGGGAGGGCCGGG + Intronic
1001315850 5:170640829-170640851 CACAGAAGGCAGGCTTGGCATGG + Intronic
1001381550 5:171309533-171309555 CAAAGGAGGCGGGCAGAGACGGG - Exonic
1001896363 5:175385318-175385340 CACAGAAGGAGAGGAGGGCATGG - Intergenic
1001954412 5:175838546-175838568 GACAGAAGGGGGGCCGGGCGCGG - Intronic
1002001654 5:176199589-176199611 TACAGAACGCGGGCAGGAGCAGG + Intergenic
1002548507 5:179969329-179969351 CAGAGAAGGCAGGCAGTGACTGG - Intronic
1006079391 6:31556500-31556522 CACAGCAGGTGGGCCTGGCCAGG + Intronic
1006144089 6:31947853-31947875 CAGAGAAGGGAGGCAGGGCAGGG + Intronic
1006239539 6:32665226-32665248 CAAAGAAGGCGGGCAGAGCTGGG - Intronic
1006248683 6:32762113-32762135 CAGAGAGGGCGGGCAGGGCTGGG - Intronic
1006439586 6:34045617-34045639 CAGACAATGGGGGCAGGGCCTGG - Intronic
1007378140 6:41470287-41470309 CTGAGAAGGCGGTGAGGGCCAGG + Intergenic
1012170960 6:96016141-96016163 CGCAGGAGGCAGGCAGGGCCAGG - Exonic
1012338756 6:98092069-98092091 GACAGAGGGAGGGCCGGGCCTGG + Intergenic
1013262680 6:108461802-108461824 CACAAAAGGCTGGCAGTGCACGG + Intronic
1015298655 6:131628233-131628255 TACGGAAGACGGGAAGGGCCCGG + Intergenic
1015637494 6:135292190-135292212 CACAAAAGTAGGGCAGTGCCTGG - Intronic
1016851599 6:148624816-148624838 CACAGAAGGGTGCCAGGGGCAGG + Intergenic
1017705723 6:157120926-157120948 CACAGAAAGCGTGCGTGGCCAGG - Intronic
1018617501 6:165702035-165702057 GCCAGGAGGCAGGCAGGGCCAGG + Intronic
1019082774 6:169446355-169446377 CAGGGAAGGTGGGCAGGGGCCGG + Intergenic
1019082791 6:169446399-169446421 CAGGGAAGGTGGGCAGGGGCCGG + Intergenic
1019163782 6:170086020-170086042 CACAGAAAGCCCTCAGGGCCAGG - Intergenic
1019307083 7:340788-340810 CACCGGAGGCGGGAGGGGCCTGG - Intergenic
1019559295 7:1647995-1648017 CCCCCAAGGCGGGCAGGCCCTGG - Intergenic
1019713527 7:2528221-2528243 CACAGGAGGAGGGCAGGGATGGG - Exonic
1019745942 7:2700432-2700454 CATGGTGGGCGGGCAGGGCCTGG - Exonic
1019930349 7:4218676-4218698 GACAGCAGGAGGGCAGGGCTGGG + Intronic
1020084335 7:5302573-5302595 CAGAGAAGGCAGGCAAGGCCTGG + Intronic
1020085509 7:5308078-5308100 CACAGGTGGCCCGCAGGGCCCGG + Exonic
1021855597 7:24851956-24851978 CACAGTAGGGGGGCAGGGCAGGG + Intronic
1024988224 7:55214011-55214033 CACAGAAGGCAGTGAGGGCAGGG - Intronic
1025247537 7:57328610-57328632 CCCAGATGTCAGGCAGGGCCTGG + Intergenic
1025258453 7:57400565-57400587 AACAGGAGGCTGACAGGGCCTGG - Intergenic
1025610191 7:63071160-63071182 AACAAAAGGCTGACAGGGCCTGG + Intergenic
1025762156 7:64405044-64405066 GAAAGAAGGGGGCCAGGGCCTGG + Intergenic
1025958260 7:66199154-66199176 CAAAGAAGGCCAGCAGGGCACGG - Intergenic
1026830918 7:73609538-73609560 CACACAAAGCGGCCAGGGCCCGG - Intronic
1028141139 7:87275649-87275671 TACAGAAGGGAGGCAGGGCAAGG + Intergenic
1029436469 7:100566711-100566733 GACAGAAGGAGGGCAGAGGCTGG - Exonic
1029465577 7:100722678-100722700 CGTAGAAGTCTGGCAGGGCCTGG + Exonic
1029622545 7:101699068-101699090 TACAGACAGTGGGCAGGGCCGGG - Intergenic
1030423130 7:109334626-109334648 CAGAGAAGGAGGGGAGGGACAGG - Intergenic
1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG + Exonic
1031929169 7:127666799-127666821 GACAGAGGGCGGGAAGGGCCTGG + Intronic
1032274263 7:130440818-130440840 CCCGGAAGGCGGGAAGGGGCCGG - Intronic
1032443665 7:131961843-131961865 GACAGAGCGCAGGCAGGGCCAGG - Intergenic
1032814354 7:135456553-135456575 CATAGAAGGTGGGGAGGTCCTGG - Intronic
1032931483 7:136677604-136677626 CACAGCAGGCAGGGAGGGACAGG + Intergenic
1034435533 7:151061229-151061251 CACAGAAGGTGGGCATGGGCTGG - Intronic
1034440173 7:151082204-151082226 CAGAGCAGGTGGCCAGGGCCTGG - Exonic
1034605671 7:152310975-152310997 CACAGATTGCTGGCAGGGCACGG - Intronic
1034608716 7:152344695-152344717 CACAAAAGGCAGGCTGGGCATGG + Intronic
1034994201 7:155567904-155567926 CAAAGAAGGCTGGAAGTGCCAGG - Intergenic
1035168017 7:157003013-157003035 CCCGCAAGGCGGGCAGAGCCGGG + Intronic
1035208388 7:157309779-157309801 CACAGAACGAGGTCAGGCCCAGG - Intergenic
1035232394 7:157473513-157473535 CAGAGGAGGCTGGCAGGCCCAGG + Intergenic
1035307562 7:157943021-157943043 CACAGCAGGAGGGCCGGGCCTGG + Intronic
1035312057 7:157975674-157975696 CACGGAGGGCAGGCAGGGGCTGG - Intronic
1036674399 8:10818088-10818110 TACAGACGGAGAGCAGGGCCTGG + Intronic
1036848247 8:12184499-12184521 CACAGGAGGCTGGCCGGGCGCGG - Intronic
1036869609 8:12426780-12426802 CACAGGAGGCTGGCCGGGCGCGG - Intronic
1037290118 8:17341455-17341477 CACTGAAGCCGGACAGGGGCTGG + Exonic
1037921434 8:22809013-22809035 CCAAGAAGTAGGGCAGGGCCTGG - Intronic
1038189154 8:25303205-25303227 CAAAGAAAACGGGCAGTGCCAGG - Intronic
1039911806 8:41832467-41832489 GCCAGAAGGTGGGCAGGGCATGG - Intronic
1039964191 8:42271758-42271780 GGCAGAAGGCGGGCAGGCCCGGG + Intronic
1040079921 8:43275532-43275554 CTCAGAAGCGGGGCAGGCCCAGG - Intergenic
1042566478 8:70117151-70117173 CACGGCAGGCTGGCAGGACCAGG - Intronic
1043821641 8:84873454-84873476 CACAGAAGCAGTACAGGGCCAGG + Intronic
1049278366 8:141731308-141731330 CACAGAATCCAGGCAAGGCCAGG + Intergenic
1049324643 8:142015632-142015654 CACAGCAGGCGGCCTGGCCCTGG - Intergenic
1049420676 8:142515185-142515207 CAGGGAAGGCGTGCAGGGCAGGG + Intronic
1049434220 8:142579108-142579130 CTGAGCGGGCGGGCAGGGCCTGG - Intergenic
1049465835 8:142750935-142750957 CACGGAAGGCGGGCAGGGCTGGG - Intronic
1049465857 8:142751019-142751041 CACAGAAGGCGGGCAGGGCCGGG - Intronic
1049542668 8:143215553-143215575 GACAGAGTGCTGGCAGGGCCGGG - Intergenic
1049661811 8:143822961-143822983 CACAGGAGGCAGGAAGGGACAGG + Intronic
1052576606 9:30299536-30299558 CACAGCAGGCAGGCAGGCTCAGG - Intergenic
1053150337 9:35739122-35739144 CACAGAAGGGAGGCAGGGAATGG + Intronic
1053533754 9:38905861-38905883 CAAACAAGGAGGGCAGGCCCCGG - Intergenic
1054205980 9:62130290-62130312 CAAACAAGGAGGGCAGGCCCCGG - Intergenic
1054632380 9:67458080-67458102 CAAACAAGGAGGGCAGGCCCCGG + Intergenic
1056755787 9:89381283-89381305 CACAGAAGGCCAGCGGGGCCTGG + Exonic
1057192119 9:93094155-93094177 CCCTGAAGGTGGGCAGTGCCTGG + Intergenic
1057197977 9:93125591-93125613 CACAGAGTGGGGTCAGGGCCTGG - Intronic
1060312745 9:122477419-122477441 CACAGAAGGAAAGCTGGGCCAGG + Exonic
1060772511 9:126342743-126342765 CAAGGAAGGCGGGGAGGGCATGG + Intronic
1061015425 9:127978494-127978516 AATAGTATGCGGGCAGGGCCTGG - Intronic
1061911487 9:133727508-133727530 CACAGCAGGTGGGCAGGTCAGGG + Intronic
1061940932 9:133883387-133883409 CACAGTGGGCAGTCAGGGCCAGG + Intronic
1062012098 9:134272867-134272889 GACAGCAGGCAGTCAGGGCCTGG - Intergenic
1062165397 9:135105031-135105053 CACAGATGGGGAGCATGGCCTGG + Intronic
1062350384 9:136135835-136135857 CACAGCAGGCGGGCTGGGCAGGG - Intergenic
1203622356 Un_KI270749v1:136224-136246 CCCAAAGGGAGGGCAGGGCCAGG - Intergenic
1186407019 X:9313202-9313224 CTCAGGAGGTGGGCAGGGCCGGG - Intergenic
1186739790 X:12505430-12505452 AAAAGAAGGAGAGCAGGGCCAGG + Intronic
1187001361 X:15182357-15182379 ATCAGAAGCCGGGCAGGGCGCGG - Intergenic
1187193040 X:17054838-17054860 CACAGAACTCAGGCAGGGTCAGG - Exonic
1189907946 X:45781237-45781259 CACATAAGGCAGGCGGGGCAGGG - Intergenic
1190059617 X:47202447-47202469 CACAGAACTGGTGCAGGGCCTGG - Exonic
1191902835 X:66056629-66056651 CACAGCAGGCGGGCGGGGGTGGG + Intergenic
1194624201 X:96209604-96209626 CACAGAAGTCGGGAAGGGTTGGG + Intergenic
1195639984 X:107162808-107162830 CACAGATGGCGGGAGGGGCCTGG + Intronic
1198854054 X:140996969-140996991 CACAAAAGGTGGGGAGGGCTTGG + Intergenic
1198877959 X:141248146-141248168 CACAAAAGGTGGGGAGGGCTTGG - Intergenic
1200951256 Y:8902133-8902155 CACAGCAGGCTGTCTGGGCCTGG - Intergenic
1201179576 Y:11332423-11332445 CAAAGCAGGCTCGCAGGGCCTGG - Intergenic
1201903877 Y:19069715-19069737 CACAGAAAGCAGGCAGCGTCTGG + Intergenic