ID: 1049466110

View in Genome Browser
Species Human (GRCh38)
Location 8:142752006-142752028
Sequence CAGTAGAGATGGAGAGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 693
Summary {0: 1, 1: 1, 2: 8, 3: 99, 4: 584}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049466110_1049466125 29 Left 1049466110 8:142752006-142752028 CCCACTCCTCTCCATCTCTACTG 0: 1
1: 1
2: 8
3: 99
4: 584
Right 1049466125 8:142752058-142752080 TGCCTTCCTTCCCCCGCTCAAGG No data
1049466110_1049466116 3 Left 1049466110 8:142752006-142752028 CCCACTCCTCTCCATCTCTACTG 0: 1
1: 1
2: 8
3: 99
4: 584
Right 1049466116 8:142752032-142752054 CCCCAGCCTCAGAGCCTCCCTGG No data
1049466110_1049466120 5 Left 1049466110 8:142752006-142752028 CCCACTCCTCTCCATCTCTACTG 0: 1
1: 1
2: 8
3: 99
4: 584
Right 1049466120 8:142752034-142752056 CCAGCCTCAGAGCCTCCCTGGGG No data
1049466110_1049466118 4 Left 1049466110 8:142752006-142752028 CCCACTCCTCTCCATCTCTACTG 0: 1
1: 1
2: 8
3: 99
4: 584
Right 1049466118 8:142752033-142752055 CCCAGCCTCAGAGCCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049466110 Original CRISPR CAGTAGAGATGGAGAGGAGT GGG (reversed) Intronic
901203583 1:7481082-7481104 CAGAAGAGAGGGAGAGAAGGAGG - Intronic
902044351 1:13513781-13513803 CAGCAGGGATGGAGAGGGGAGGG + Exonic
902076882 1:13794105-13794127 CAGAAGAGATGGTGAGGTGCAGG + Intronic
902672058 1:17981488-17981510 CAGAAGAGCTGGAGAGGGCTGGG - Intergenic
903064562 1:20691925-20691947 TAGCAAAGATGGAGAGAAGTGGG - Intronic
903775466 1:25790599-25790621 CACTAGAGATGGAGAGGTCAGGG + Intergenic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905776382 1:40669985-40670007 CAAGAGGGATGGAGAGAAGTGGG - Intergenic
905836018 1:41121971-41121993 CAGTAGAGATGGTGAAATGTGGG - Intronic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906389980 1:45406688-45406710 TAGTAAAGGTGAAGAGGAGTTGG - Intronic
906920624 1:50060782-50060804 AAGAAGAGATGGAGTGGTGTGGG - Intronic
907126417 1:52055024-52055046 CAGAAGAGATGACGAGGAGCAGG + Exonic
907289876 1:53406968-53406990 CTGGAAGGATGGAGAGGAGTGGG + Intergenic
907302386 1:53496428-53496450 CATTAGGGATAGGGAGGAGTGGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907839509 1:58142760-58142782 CAGGAAAGATGGAGAGAGGTAGG - Intronic
908777336 1:67653249-67653271 CAGTGGAAGTGGGGAGGAGTAGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909132490 1:71755260-71755282 CAGTGGAGGTGAAGAGGACTCGG - Intronic
909914235 1:81298052-81298074 CAGAGAAGATGGAGAGGACTGGG + Intergenic
910044310 1:82893078-82893100 AAGTAAAGATGGAGAATAGTTGG - Intergenic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
910313584 1:85856679-85856701 CAGTGGAGGTGGGGAAGAGTAGG - Intronic
910441804 1:87260675-87260697 GAGTAGGGATGGAGAGGAAAAGG + Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
910844014 1:91588033-91588055 CAGGAATGAGGGAGAGGAGTTGG - Intergenic
911010185 1:93272925-93272947 CAGGAGAGCAGTAGAGGAGTTGG + Intronic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
915294207 1:154908742-154908764 CAAGAGAGAGGGAGTGGAGTGGG + Intergenic
915482402 1:156195868-156195890 GAGTAGAGGTGGAGAGGAGGAGG + Intronic
915491799 1:156254186-156254208 CAGTAGTCAAGGAGAGGTGTTGG - Intronic
915546754 1:156603419-156603441 TAGAAGAGATGGAGAGGTGGGGG - Intergenic
915594588 1:156888812-156888834 CAGTGGAGGTGCTGAGGAGTGGG - Intergenic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915802238 1:158806786-158806808 GAGCAGAGATGGAAAGGTGTTGG - Intergenic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
917042580 1:170822442-170822464 CACTAGAGATGGAGGGGAGATGG - Intergenic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917271179 1:173276348-173276370 TGGTAGAGGTGGAGAGGAGAAGG - Intergenic
917922436 1:179762005-179762027 CAGTAGGGAAGTGGAGGAGTGGG - Intronic
918418987 1:184342832-184342854 CAACAGAGATGGAGGGCAGTGGG - Intergenic
918691290 1:187483359-187483381 CAGTGGAGATGGAGGGGTTTGGG - Intergenic
918709833 1:187713331-187713353 CAGTAGTAATGAAGAAGAGTAGG - Intergenic
919087185 1:192934218-192934240 CTGAAGAGATGGAGTGGAGGTGG - Intergenic
919158879 1:193803050-193803072 GAATTGAGATGGAGAGGAGTTGG + Intergenic
919429889 1:197479452-197479474 CAAAAGAGATGGAGAGGGGATGG - Intergenic
919664438 1:200278729-200278751 CAGTAGAGATAGAGAGAGGGAGG + Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
919800932 1:201354260-201354282 CAGTAGAGGTGGGGTTGAGTGGG - Intergenic
920106298 1:203555901-203555923 CAGGAGAGACGGAGAGGAGGGGG + Intergenic
920727449 1:208449575-208449597 CAGTAGAGATGAAGTGGAACGGG - Intergenic
920929648 1:210375226-210375248 GATTAGAGATGAAGAGGAGGAGG - Intronic
921799348 1:219384010-219384032 CAGTAGGGAAGGAGAGGGGAAGG - Intergenic
922009741 1:221571015-221571037 CACTAAAGATGGAGAGGATTTGG - Intergenic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923271258 1:232357172-232357194 CAGTGGAGGTGGTGAGGCGTGGG + Intergenic
923310524 1:232730355-232730377 TGGTAGAAATGGAGAGAAGTAGG - Intergenic
924753045 1:246914888-246914910 CAGTAGAAATGGAGAAGATGGGG - Intronic
1062808857 10:447210-447232 GAGTATAGATGGGGATGAGTGGG - Intronic
1062808898 10:447410-447432 GAGTATAGATGGGGATGAGTGGG - Intronic
1062809027 10:448108-448130 GAGTATAGATGGGGATGAGTGGG - Intronic
1063371708 10:5526584-5526606 CACTAGAGATGGTGAGGGGTTGG + Exonic
1064325135 10:14343433-14343455 GAGGGGAGATGGAGAGGAGCTGG - Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1064833072 10:19493191-19493213 TTATAGAGATGGAGAGGAGAAGG - Intronic
1064969615 10:21051375-21051397 GAGTAGAGATGTAAAGCAGTAGG + Intronic
1066331188 10:34425114-34425136 CAGTAGAGATGGAAAAAAATTGG - Intronic
1067135264 10:43602215-43602237 TAGGAAGGATGGAGAGGAGTTGG + Intergenic
1068646989 10:59479144-59479166 TAGCAGAGATGGAAAGGATTTGG - Intergenic
1068957583 10:62832954-62832976 CAGAAAAGATGAAGAGGAGATGG + Intronic
1069166931 10:65171894-65171916 TAGTGGAGATGGAGAAGAATAGG + Intergenic
1069706263 10:70460575-70460597 CAGAAGAGATGGGGAGGAGCAGG - Intergenic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1070195057 10:74149705-74149727 CAGAAGAGAAGGAAAGGAATGGG - Intronic
1070541805 10:77420817-77420839 AAGCTGAGATGGAGAGAAGTGGG - Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071705683 10:87995909-87995931 AAGTATAGAGGGAGATGAGTAGG - Intergenic
1071981965 10:91012491-91012513 CAGTATAGTTGGAGAAAAGTTGG + Intergenic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1074052873 10:109895764-109895786 TATTAGAAATGGAGAGAAGTGGG - Intronic
1074391039 10:113058335-113058357 GAGTAGAGATGAAGAGGGGGTGG + Intronic
1074524503 10:114252336-114252358 GAGTAGAGATTGAGGGGAGGAGG + Intronic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1074886637 10:117699224-117699246 AGGGAGTGATGGAGAGGAGTGGG + Intergenic
1075084706 10:119406788-119406810 CAGTAGTGAGGGACAGGGGTTGG + Intronic
1075239356 10:120764132-120764154 AAGGAGAGAGGGAGATGAGTGGG + Intergenic
1075262094 10:120971906-120971928 CAGTAGGGATGGATAGGGTTCGG - Intergenic
1075317440 10:121464387-121464409 CAGATGACATGCAGAGGAGTTGG - Intergenic
1075464776 10:122643148-122643170 GCGAAGAGATGGCGAGGAGTAGG - Exonic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1076899720 10:133332190-133332212 CATTGGAAATGGAGAGGTGTGGG + Intronic
1078148444 11:8738590-8738612 CAGCAGGGATGGGGAGGAGGGGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1080514431 11:33006899-33006921 AAGTGGAGATGTAGTGGAGTTGG + Intergenic
1080557368 11:33429919-33429941 CAGAAGAGATGGTGAGGGGTAGG - Intergenic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081329445 11:41786447-41786469 CCAAAGAGATGGAGAGCAGTAGG - Intergenic
1081416751 11:42824480-42824502 CAGGAGAGTAGGAGAGGGGTTGG - Intergenic
1081517092 11:43843631-43843653 GAGAAGAACTGGAGAGGAGTTGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082957422 11:58885408-58885430 AAGGAGAGATGGAAAGGACTAGG - Intronic
1084074921 11:66766394-66766416 CAGTAGAGAAGTAGGTGAGTAGG - Intronic
1084461614 11:69299459-69299481 CAGGGGAGATGCAGAGGAGGGGG + Intronic
1084470418 11:69356190-69356212 AAGGAGGGAGGGAGAGGAGTAGG + Intronic
1085014962 11:73167909-73167931 TAGGAGAGAGGGAGAGAAGTGGG + Intergenic
1085198603 11:74687759-74687781 CAACAGAGAGGGAGAGAAGTGGG - Intergenic
1085281915 11:75336477-75336499 CATTAGTGAAGGACAGGAGTAGG - Intronic
1085591165 11:77762403-77762425 CACTAGGGATGGAAAGGAGGGGG - Intronic
1086074866 11:82839777-82839799 TAGTGGAGTGGGAGAGGAGTTGG - Intronic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1086406481 11:86503435-86503457 CAGAAGTGAGGCAGAGGAGTGGG - Intronic
1086796868 11:91115827-91115849 CAGTAGAGATGATGATGTGTAGG - Intergenic
1086964314 11:93011861-93011883 CCACAGAGAGGGAGAGGAGTAGG - Intergenic
1087017834 11:93571852-93571874 CAGAAGAGACAGAGAGGAGGTGG + Intergenic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1088245843 11:107817336-107817358 CATTAGAGATGGAGATAAGAGGG + Intronic
1088549854 11:111001666-111001688 CAGTAGAGCTGGAGAAGAGAAGG + Intergenic
1088795469 11:113263836-113263858 CAGTAGAGAAGGAGAGGGACAGG + Intronic
1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG + Intronic
1088893064 11:114059608-114059630 CACTAAAGATGGAGAGGCGCCGG + Exonic
1089116204 11:116097102-116097124 CAGTAATGTTGCAGAGGAGTGGG - Intergenic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089780448 11:120869937-120869959 CAGCAGAGATGGAAAAGATTTGG - Intronic
1091340352 11:134807405-134807427 CACTGGAGATAGAGAGGAGGAGG + Intergenic
1091632546 12:2172919-2172941 CAGCAGAGTTGGTGAGGAGCTGG + Intronic
1091944109 12:4519853-4519875 CAGGAGAGCTGGAGAGGGTTTGG - Intronic
1091980155 12:4858212-4858234 CAGGAGAGAGGGAAAGGAGCTGG + Intergenic
1092094656 12:5831672-5831694 CAGCAGAGATGGATAGGAGATGG + Intronic
1092239470 12:6828333-6828355 AAGGAGAGATGGAGAGGCGGAGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092575374 12:9776783-9776805 CATTAGAGATGGCCAGGAGTTGG - Intergenic
1093713004 12:22349292-22349314 CAGTAGAGATGAAGAAAAGAGGG + Intronic
1093953731 12:25193568-25193590 CAGTAGATTTGGAGTTGAGTGGG + Intronic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1094088627 12:26622794-26622816 CATGACAGATGGGGAGGAGTGGG + Intronic
1094361349 12:29634558-29634580 CAGTAGTGATGGAGTGAAATCGG + Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1094624759 12:32113177-32113199 CAGTAGGGATCGTGAGGAGGGGG + Intronic
1094671994 12:32579482-32579504 GAGTAGGGAGGGAGAGGAGACGG - Intronic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1096123827 12:49105613-49105635 CAATAGGGAGGGAGTGGAGTGGG - Intronic
1096571959 12:52528693-52528715 GGGTAGAGATGGAGAGCATTTGG - Intergenic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1097650994 12:62297063-62297085 CAGGAAGGAAGGAGAGGAGTGGG + Intronic
1097734144 12:63163640-63163662 GAGTAGGGATGGAGAGGCATTGG - Intergenic
1097768619 12:63553854-63553876 CAGGAGATCAGGAGAGGAGTTGG - Intergenic
1097784979 12:63748895-63748917 CAGGAGATCAGGAGAGGAGTTGG - Intergenic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098055208 12:66497724-66497746 CAGCAAAAATGGAGAGGAGCAGG + Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098483693 12:70996318-70996340 CAGTTGAAATGGGGAAGAGTGGG - Intergenic
1098804780 12:75009849-75009871 AAGTTCAGATGGAGAAGAGTTGG + Intergenic
1099156376 12:79181528-79181550 CGGTTGATATGGAGAAGAGTGGG - Intronic
1100373945 12:93994908-93994930 CAGGAGAGAGGGACAGGAATTGG - Intergenic
1101210447 12:102530211-102530233 AAGCAGTGATGGAGAGGAGGAGG - Intergenic
1101272483 12:103162287-103162309 AGGTAGAGATTGACAGGAGTGGG - Intronic
1101523582 12:105507186-105507208 CAGGAGAGAGGGAAGGGAGTAGG - Intergenic
1101562843 12:105875558-105875580 CAGCAGATAAGCAGAGGAGTCGG - Intergenic
1101725891 12:107387927-107387949 GAAAAGAGAAGGAGAGGAGTAGG - Intronic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1102172585 12:110853381-110853403 TGGGGGAGATGGAGAGGAGTGGG - Intronic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1102807093 12:115791608-115791630 CAGAAGAGATGGAGAGGCCTAGG + Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103449223 12:121016405-121016427 CAGTAGCGATGCGGAGGAGCTGG - Exonic
1103781581 12:123402319-123402341 GAATGGAGATGGAGAGGAGGTGG + Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1105042652 12:132972698-132972720 AAGCAGAAATGGAGAGGAGGAGG - Intergenic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105605447 13:21922957-21922979 CAGTGGAGATGGACAAGTGTCGG + Intergenic
1106524451 13:30527629-30527651 AAAAAGAGATGGAGAGGAGATGG + Intronic
1107317542 13:39149995-39150017 AAGTAGAGAAGGAAAGAAGTCGG + Intergenic
1109065130 13:57677589-57677611 CAGTAAGGAAGGAGAGGGGTAGG + Intronic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1111723782 13:91978875-91978897 CAGTAGAAATGAAGAGGACTTGG + Intronic
1111906659 13:94263178-94263200 CAGAAGACTTGGAGAAGAGTTGG + Intronic
1111947784 13:94683487-94683509 CAGTAGAGGTTGAGGGGAGCAGG + Intergenic
1112577580 13:100650023-100650045 CAGTCTTGATGGAGAGGAGATGG - Intronic
1113033181 13:106017056-106017078 TATCAGAGATGGAGAGGAGGTGG - Intergenic
1113924588 13:113934406-113934428 CAGGATGGATGGAGATGAGTCGG + Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1114476606 14:22999449-22999471 CAGTAAAGATGGTGAGGAGGAGG - Intronic
1114523649 14:23354125-23354147 TGGTAGAGATGGAGAGATGTGGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115001112 14:28420731-28420753 CAAAAGAGATGGTGAGAAGTGGG - Intergenic
1115102825 14:29723587-29723609 CAATAGAGTGGGAGAGGAGCTGG + Intronic
1115141746 14:30179614-30179636 GAGGAGAGATGGAGAGAACTAGG + Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1117026997 14:51630978-51631000 CAGAAGGAATGTAGAGGAGTGGG + Intronic
1117201917 14:53399053-53399075 CAGTGGAGATGGGGTGGGGTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117985038 14:61378834-61378856 TAGAAGGGATGGAGAGGAGAGGG - Intronic
1118151773 14:63197257-63197279 CAGTAGCCATGGACAGAAGTAGG - Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118608623 14:67522252-67522274 CAGTAGAGTGGGAGAGGAGCGGG - Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119477369 14:74938926-74938948 GAGGAGAGAGAGAGAGGAGTGGG - Intergenic
1119697156 14:76722008-76722030 CCTGAGAGATGAAGAGGAGTGGG + Intergenic
1121498221 14:94412505-94412527 CAGTATAGCTGGAGTGGAATGGG - Intergenic
1121569120 14:94933400-94933422 CAGTACATAGGCAGAGGAGTTGG - Intergenic
1121777075 14:96598140-96598162 CAGGAGAAAGGGAGAGGAGGGGG - Intergenic
1122149606 14:99717830-99717852 AAGTGGAGGTGGAGAGGAATGGG - Intronic
1122403765 14:101484238-101484260 CAGGAGGGAGGGAGAGAAGTTGG + Intergenic
1122629156 14:103099438-103099460 TGGTGGAGAGGGAGAGGAGTGGG + Intergenic
1123222156 14:106867255-106867277 CACTAGTGCTGGAGAAGAGTGGG - Intergenic
1124429411 15:29593459-29593481 CAGCTGAGATGGAGTGGACTGGG - Intergenic
1125012637 15:34897072-34897094 CAGAAGAGATTGAGAGAACTGGG - Intronic
1125329142 15:38565015-38565037 CAGGGGAGTTGGAGAGGAGCGGG + Intronic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1125718671 15:41834781-41834803 CGGTAGAAGTGGAGCGGAGTTGG - Exonic
1126853930 15:52818988-52819010 CAGTAGAGAGGCAGAAGAATGGG + Intergenic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127572742 15:60260268-60260290 CAGAAGAGGTGAAGAGGAGAAGG - Intergenic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1128526741 15:68417399-68417421 CAGAAGAGACAGAGAGGAGTGGG - Intronic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1130523375 15:84682097-84682119 GAGTAGAGATGGAGCAGAATTGG + Intronic
1130743268 15:86624029-86624051 GAATAGAGATTGAGAGGAATGGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131666246 15:94573820-94573842 CAGTAGAGTTGCAAAGGTGTGGG + Intergenic
1131709135 15:95033821-95033843 CAGTAGAGAGGAAGAGGAGGAGG - Intergenic
1131857674 15:96616147-96616169 GAGTAGAGAGAGAGAGGAGAAGG - Intergenic
1132175272 15:99709161-99709183 CAGTAGAGATGGTGAGACCTGGG + Intronic
1132224895 15:100132787-100132809 CAGGAGAGATGGGGAGGTGTTGG - Intronic
1134201765 16:12205094-12205116 CAGTGAAGATGGAGAGTCGTGGG + Intronic
1134692057 16:16197590-16197612 CAGGAGAGAGGAAGAGGAGGAGG + Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135260987 16:20980553-20980575 TAGTAGAGATGGTGGGGGGTGGG + Intronic
1136354644 16:29736305-29736327 CAGGAGAGAGAAAGAGGAGTGGG + Intergenic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1137432233 16:48427684-48427706 CAGGAGAGAGGGAGAGGTGGAGG - Intronic
1139341657 16:66271470-66271492 CAGCAGAGATAGAGAGGCCTGGG - Intergenic
1140285833 16:73601921-73601943 CAGGAGAGAGGAAGGGGAGTGGG + Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141392432 16:83676067-83676089 CAGGAAAGAAGGAGAGGAGGAGG + Intronic
1142052013 16:87965147-87965169 CAGCAGAGAGACAGAGGAGTGGG + Intronic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1143130041 17:4672317-4672339 CAGCAGTGATGAAGAGGAGGAGG - Exonic
1143352167 17:6296999-6297021 TAGTAGAGATGGGGAGGAGGTGG - Intergenic
1144036011 17:11366653-11366675 CAGGACAGATGGAGAAGAGTGGG + Intronic
1144211202 17:13017291-13017313 TAGCAGAGGTGGAGAGGAGTGGG + Intronic
1144212866 17:13030049-13030071 GAGGAGAGAGAGAGAGGAGTGGG - Intergenic
1144678282 17:17175659-17175681 TAGCAGAAATGGAGGGGAGTGGG - Intronic
1144744718 17:17606371-17606393 CCCTAGAGATGGAGTGGAGTAGG - Intergenic
1144901534 17:18597610-18597632 GAATTGAGATGGAGAAGAGTTGG - Intergenic
1146506867 17:33413459-33413481 CAACAGAGAGGGAGAGAAGTGGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146778882 17:35648830-35648852 GAGTTGAGATGGAGAAGGGTTGG + Intronic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1147899218 17:43773044-43773066 CAGTACAGCTGGAGTGGAGGAGG + Intronic
1148457455 17:47818620-47818642 CAGAAGTGATGGAGAGGGGGAGG + Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1150042109 17:61874215-61874237 CAGGAAAGATGCAGAGGAGATGG - Intronic
1150237560 17:63605300-63605322 CAGTAGAAAGGGAGAGGATGGGG + Intronic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1151303474 17:73246661-73246683 CACTAGGGATGGAAAGGAGCAGG - Intronic
1151941915 17:77298010-77298032 CAGTAGAGCAGGCGAGGAGGAGG + Intronic
1152816278 17:82410018-82410040 CAGGAGAGATGGGGAGCAGTGGG - Intronic
1152885209 17:82845438-82845460 CAGACGAGATGGAGAGGAAGGGG - Intronic
1153521398 18:5957785-5957807 CAGTAGAGATGGAGCAGGGGCGG - Intronic
1154473184 18:14724633-14724655 CAGTGAAGATGCAGAGGAATTGG - Intergenic
1155078041 18:22380270-22380292 CAGTGGTGATGGAGCGGGGTGGG + Intergenic
1155236200 18:23821866-23821888 CAGAAGAGAAGGAAAGGAGAGGG - Intronic
1155292833 18:24358475-24358497 AAGCTGAGATGGAGATGAGTGGG - Intronic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155687629 18:28574814-28574836 CAGGAGAGATGATGAGGTGTGGG + Intergenic
1156088851 18:33440930-33440952 CGGTAAAGAGGGAAAGGAGTTGG - Intronic
1156761308 18:40594540-40594562 CAGTAGAGATGAAAAGATGTGGG - Intergenic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157505301 18:48222038-48222060 CAGTATAGAAGGAGAAGACTAGG - Intronic
1157694090 18:49707016-49707038 GACTAGAGATGGGGACGAGTGGG - Intergenic
1157726886 18:49971250-49971272 GAGTAGAGAGGGCGAGAAGTGGG + Intronic
1157953810 18:52071862-52071884 TCATAGAGATGGAGAGTAGTAGG - Intergenic
1158049710 18:53201937-53201959 CAGTAGAGATGGATTGGAATGGG + Intronic
1158158533 18:54453231-54453253 CAGGAGAGAGAGAGAGGAGGGGG + Intergenic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1158987627 18:62834875-62834897 TCTTAGGGATGGAGAGGAGTGGG - Intronic
1159015719 18:63100385-63100407 AATAAGAGATGGAGAGGAGGTGG - Intergenic
1159194214 18:65090853-65090875 GAGGAGAGAAGAAGAGGAGTGGG - Intergenic
1160133006 18:76246414-76246436 CATTGGAGATGGACAGGAGAAGG - Intergenic
1161347207 19:3774356-3774378 CCCTAGAGATGGAAAGGAGAGGG + Intergenic
1161453080 19:4357488-4357510 CGGGAGAGAGGGAGAGGGGTTGG - Intronic
1161518750 19:4711822-4711844 CAGAAGAGAAGAAGAGGAGGAGG + Intronic
1161521201 19:4724346-4724368 TAGTAGAGATGGGGTGGGGTGGG + Intronic
1161597382 19:5157527-5157549 CAGCAGACATGGAGAAGAGGAGG - Intergenic
1162080127 19:8212818-8212840 TAGTAGAGATGAAGGGGGGTGGG + Intronic
1162991440 19:14305203-14305225 CAGAAGAGATGGGGAGGAACTGG - Intergenic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163796110 19:19338947-19338969 CAGGAGGGAAGGAGGGGAGTGGG - Intronic
1163831307 19:19548351-19548373 CAGCAGGGATGGGGAGGAGCTGG - Intergenic
1164292272 19:23879381-23879403 GAGGAGAGAAGGAGAGGAGATGG + Intergenic
1164292445 19:23880379-23880401 GAGGAGAGAAGGAGAGGAGGAGG + Intergenic
1166034579 19:40158431-40158453 CAGTAGAAAGGGTGGGGAGTGGG - Intergenic
1166142966 19:40815232-40815254 GAGAAGAGATGGAGAGGAAAAGG - Intronic
1166549352 19:43654873-43654895 CAGTGGAGCAGGGGAGGAGTGGG + Intronic
1166893543 19:46009050-46009072 CATTACAGATGGAGATGAGTAGG + Intronic
1167148475 19:47695937-47695959 CAGAAGACAAGGAGAGGAGCAGG + Intronic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925122713 2:1431959-1431981 GAGTAGAGTTGGGGAGGTGTTGG - Intronic
925159728 2:1675682-1675704 TAGAAGAGATGGACAGGAGCAGG - Intronic
926425899 2:12738469-12738491 GAGGAGGGATGGGGAGGAGTTGG - Intronic
926560051 2:14406863-14406885 CAGTGGAGATGAAGAAGAGTAGG - Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926665864 2:15522266-15522288 CACTAGAAATGGGGAGGAGGAGG + Intronic
927453956 2:23233099-23233121 CAGGAGGGGTGGGGAGGAGTAGG + Intergenic
928219614 2:29392692-29392714 CAATCGGGATGGGGAGGAGTAGG + Intronic
929406851 2:41652227-41652249 AAGTAGAGAAAGAAAGGAGTAGG + Intergenic
929836098 2:45401201-45401223 CACTAGGGAGGGTGAGGAGTAGG + Intronic
930364313 2:50420021-50420043 CAGCAGAGATAAAGAGGATTTGG + Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930765969 2:55085412-55085434 CTGGAGACCTGGAGAGGAGTGGG + Intronic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931777650 2:65554163-65554185 CAGTTGAGGTGGAGAGTGGTAGG + Intergenic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932114031 2:69029042-69029064 TAGTAGAGATGGAGGGGGGGGGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932580590 2:72990502-72990524 CAGTAGCAATGAAGAGGAGGGGG + Intronic
933584276 2:84162660-84162682 CAGTAGAGACTGTGAGGAGGAGG - Intergenic
934087901 2:88525509-88525531 CAGGGAAGATGGGGAGGAGTGGG + Intronic
935828000 2:106970539-106970561 CAGTAGGGATGGAAAAGAATGGG + Intergenic
936260267 2:110953818-110953840 CAGGAGAGAGAGAGAGAAGTCGG + Intronic
936341086 2:111633292-111633314 CAGCATAAAGGGAGAGGAGTGGG - Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936843072 2:116797453-116797475 CAGTAGGGATGTGGGGGAGTGGG + Intergenic
936981478 2:118269181-118269203 CGGGAGAGATGGAGGGGAGGAGG + Intergenic
936985503 2:118308664-118308686 CTGAAGAGAGGAAGAGGAGTAGG + Intergenic
937349745 2:121153365-121153387 CCATAGAGATGAAGAGGAGATGG - Intergenic
939167141 2:138652145-138652167 TAGTGGAGAGGGAGAGGTGTGGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
939835386 2:147124138-147124160 GAGTAGAGAAGGAGAGAAATGGG + Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940382008 2:153025699-153025721 CAGCAGATATAGAGAGAAGTGGG - Intergenic
940446082 2:153778694-153778716 TAATAGAGATTGAGAAGAGTTGG - Intergenic
942033071 2:171982420-171982442 CAGCAGAGATGGAGAGGACAGGG - Intronic
942983285 2:182107556-182107578 CATAAGAGAAGGTGAGGAGTAGG - Intronic
943095699 2:183426615-183426637 GAGAAGAGAAGGAGAGGAGGAGG + Intergenic
943507996 2:188786034-188786056 GAGTAGGGATGGCGAGTAGTGGG - Intronic
943565649 2:189513185-189513207 AAATAAAGATGGAGAGGAATTGG - Intergenic
943748385 2:191486106-191486128 CAAGGGAAATGGAGAGGAGTGGG - Intergenic
944326048 2:198404935-198404957 AAGAAGAGATGAAGAGGGGTAGG - Intronic
944457179 2:199907849-199907871 CAGTTGAGAGGGAGAGGAGTGGG - Intergenic
944637596 2:201689825-201689847 CAAGTGAGATGGAGAGGAGGCGG + Intronic
944877058 2:203972939-203972961 GAGTGGAGTTGGAGAAGAGTGGG - Intergenic
945414923 2:209559175-209559197 CTTTAGAAAAGGAGAGGAGTTGG - Intronic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
945915928 2:215703844-215703866 CAGATGAGATAGAGAGGATTTGG - Intergenic
946226303 2:218265770-218265792 CAGGAAGGAAGGAGAGGAGTCGG + Intronic
946540069 2:220674783-220674805 CAGTACAGATGAAAAGGAGAGGG + Intergenic
946708802 2:222485769-222485791 CAGGAGAGCTGGTGAGGAGTTGG - Intronic
946867924 2:224059186-224059208 CAGTATAGATGCTGAGAAGTGGG + Intergenic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
947836733 2:233181117-233181139 CAGGAGAGAAGGATGGGAGTGGG - Intronic
948292120 2:236833400-236833422 ATGAAGAGATGGAGAGGACTGGG - Intergenic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948804134 2:240446113-240446135 CAGCAGAGAAGGAGAGGCTTGGG + Intronic
949043286 2:241859074-241859096 CAGAGGAGATGGGGAGGAGGTGG + Intergenic
1169742625 20:8911747-8911769 CAGTAAAGATGTAGAGCAATTGG + Intronic
1169811178 20:9610889-9610911 CAGAAGAGATGGAGGGGAAATGG - Intronic
1170375260 20:15692980-15693002 CAGGAGAGAGAGAGAAGAGTGGG - Intronic
1170495800 20:16923969-16923991 CAGAAGTGAGGGAAAGGAGTAGG - Intergenic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171436960 20:25131392-25131414 CAGAAGAGAGGGAAAGGAGGAGG + Intergenic
1172389053 20:34553811-34553833 AATGAAAGATGGAGAGGAGTCGG - Intronic
1172736908 20:37133410-37133432 CTTCAGAGATGGAGAGGAGGAGG - Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1173908655 20:46647612-46647634 CAGCAGGGATGAAAAGGAGTGGG - Intronic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1175198504 20:57262934-57262956 CAGTAGGGTTGGAGAGGGTTGGG - Intronic
1175417483 20:58811393-58811415 CAGAAGAGGAAGAGAGGAGTAGG - Intergenic
1176801300 21:13433216-13433238 CAGTGAAGATGCAGAGGAATTGG + Intergenic
1177437120 21:21069787-21069809 AGGTAGACATCGAGAGGAGTTGG - Intronic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177774347 21:25551272-25551294 CAGTAGAGATGGACAGATGTAGG + Intergenic
1178740429 21:35195131-35195153 CATGAGAGGTGGAGAGGAGGTGG - Intronic
1178809863 21:35871808-35871830 CAGTGCAGATGGACAAGAGTCGG - Intronic
1178832564 21:36069042-36069064 AGGGAGAGATGAAGAGGAGTGGG - Intronic
1179464061 21:41559789-41559811 CAGAAGAAATGAAGAGGAGAAGG + Intergenic
1179496188 21:41772646-41772668 CAGTAGAGGTGGGCAGGGGTGGG - Intergenic
1179973202 21:44847685-44847707 CAGGACAGATGGAGGGGAGTGGG - Intergenic
1180845100 22:18976470-18976492 CAGGAGAGATGCAGAGCACTAGG - Intergenic
1180994460 22:19958701-19958723 TGGTAGAGATGGAGTGGAGGTGG - Intronic
1182222369 22:28768896-28768918 CAATAGAGTTAGAGAGGAATGGG + Intergenic
1183232308 22:36590654-36590676 CTGTAGAGAAGGATAAGAGTGGG - Intronic
1183294781 22:37023047-37023069 CAGGAAAGATAGAGAGGAGAGGG + Exonic
1184041891 22:41949282-41949304 CAGAAGAGATGGATGGGAGGAGG + Intergenic
1184193766 22:42912551-42912573 CAGTAAAGGTGGAGTTGAGTGGG - Intronic
1184488541 22:44795962-44795984 CTGCAGACATGGAAAGGAGTAGG - Intronic
1184876852 22:47281776-47281798 CAGAAGAGGTGGGGAGGGGTGGG - Intergenic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
949173120 3:1026706-1026728 CAGTAGTTATGGCGAGGAGTTGG + Intergenic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950119772 3:10474097-10474119 CAGTGGTGTTGGAGAGGTGTGGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950443498 3:13023185-13023207 CTGTAGGGATGGAGTGGGGTGGG + Intronic
951227604 3:20139078-20139100 TTGTAGAGATGGTGAGGGGTTGG + Intronic
951383711 3:22018943-22018965 GGGTAGAGACGGAAAGGAGTAGG - Intronic
951651302 3:24954652-24954674 CAATAGAGAGGGAGAGAAGGGGG + Intergenic
953030444 3:39176467-39176489 CAGTAGTGAAAGAGAGGAGGAGG - Intergenic
953237811 3:41121402-41121424 AAGTGGAAATGGAGAGGGGTTGG + Intergenic
953279437 3:41539461-41539483 TAGTAGTGTTGGAGAGTAGTAGG - Intronic
953924931 3:46978014-46978036 CAGTGGAGGTGGAGAGGGGGCGG - Intronic
954444577 3:50539856-50539878 CAGTGGAGATGGGTAGGTGTGGG - Intergenic
954489799 3:50892759-50892781 CAGGAGGGAGGGTGAGGAGTGGG + Intronic
954984741 3:54779696-54779718 CAGTAGAGAAGCAGAGCAGCAGG - Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956878644 3:73488863-73488885 CAGCAGAGATGGGGAGGAGGGGG - Intronic
959520924 3:107322155-107322177 CAGTAGGGAGGGAGAGGCGGAGG - Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
959924341 3:111904718-111904740 CAATAGAGAGGGAAAGGTGTAGG + Intronic
960078302 3:113513710-113513732 TAGTAGAGATGGAGAAGAGCGGG - Intronic
960184963 3:114627092-114627114 GAGTAGAGTTGGAAAAGAGTGGG - Intronic
961198380 3:125023279-125023301 CACTAGAGATGGACAGGCCTGGG - Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
962454183 3:135549892-135549914 CAGTAGGGAGGGGGAGGAGCTGG + Intergenic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
962838488 3:139211706-139211728 CAGTACATATGGCAAGGAGTGGG + Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963135249 3:141897211-141897233 CACCAAAGATGGAGAGGAGGAGG - Intronic
963371583 3:144407815-144407837 CAGTAGAGATGAAGAACAGCTGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963836997 3:150067898-150067920 CGGCAGAGGTGGAAAGGAGTGGG + Intergenic
965129372 3:164675630-164675652 CCACAGACATGGAGAGGAGTTGG - Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967347172 3:188470465-188470487 GAGTTGAGATGGAGAAGATTTGG - Intronic
967779888 3:193425708-193425730 GAATAGAGATAGAGAGGAGAAGG + Intronic
967992791 3:195144199-195144221 CACTCGAGATGGAGTGGAGTGGG - Intronic
968270256 3:197397966-197397988 GAGGACAGATTGAGAGGAGTCGG + Intergenic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971251877 4:24979424-24979446 GAGAAGACATGGAGAGAAGTGGG + Intronic
972988128 4:44790811-44790833 CAGGGGAGATGAAGAGGGGTTGG - Intergenic
973636251 4:52863680-52863702 CAGCAGAGAAGGAGAGGGGTGGG - Intronic
973735294 4:53865399-53865421 CAGAAGTGATGGAGAGGAACTGG - Intronic
973945907 4:55955537-55955559 CAGAAGAGATAGAGAAAAGTGGG + Intronic
974178169 4:58351356-58351378 CAATAGAGATGGGGAGGAGGAGG + Intergenic
975110373 4:70616850-70616872 GAGGAGGGATGGAGAGTAGTAGG + Intergenic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976540443 4:86268289-86268311 CAGTAAAGATGGTGAGAAGATGG - Intronic
976952115 4:90846703-90846725 CAGGAGAGATGAAGACGGGTTGG - Intronic
977796507 4:101172062-101172084 AAGTACTGATGGAGAGCAGTGGG + Intronic
978105574 4:104898132-104898154 TAATAGAAATGTAGAGGAGTGGG + Intergenic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979041331 4:115800746-115800768 CAGGAGAGAGTGAGATGAGTAGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981651946 4:147070185-147070207 CAGTAGAAATAGAGAGGAAAAGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981663971 4:147200436-147200458 AAGTAGTGATGGGGAGGAGGGGG + Intergenic
981855451 4:149285296-149285318 CAGTAGAGATAAACAGGTGTGGG - Intergenic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982435812 4:155383025-155383047 CTGCAGAGAGGGAGAGGAGGAGG - Intergenic
982442571 4:155454098-155454120 CTGTAGTGCTGGAGTGGAGTAGG + Intergenic
983289916 4:165789289-165789311 CAGGAGAGAGGGAGTTGAGTGGG - Intergenic
983345188 4:166520363-166520385 CTGAAGAGATGGAAAGGTGTAGG + Intergenic
984592494 4:181632213-181632235 CAGGAGAGAGAGAGTGGAGTGGG + Intergenic
984592924 4:181636641-181636663 CAGCAGAGGTGGGGAGAAGTGGG - Intergenic
984757148 4:183335710-183335732 CAGAAGAGAGGAAGAGGTGTGGG - Intergenic
985139972 4:186829833-186829855 CTGTAGGGATTGAGAGGACTTGG - Intergenic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986304421 5:6504892-6504914 CAGGAAAGATGGAGCTGAGTGGG - Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
988656609 5:33218777-33218799 CATTAGGGATGGAGAGGAAGAGG - Intergenic
988907315 5:35802749-35802771 CAGCAGAGCTGGAGAGGACCAGG + Intronic
989125539 5:38049108-38049130 CAGGGGAGTGGGAGAGGAGTGGG + Intergenic
989258014 5:39387119-39387141 CAAATGAGATGGAGAGGAGCAGG - Intronic
989414260 5:41155214-41155236 AAGTAGAAATTGAGAGGACTTGG - Intronic
990126597 5:52526405-52526427 GAGTAGAGAGGGAGAGGATCAGG - Intergenic
990707742 5:58548948-58548970 GGGTAGAGATAGAGATGAGTAGG + Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991350635 5:65717219-65717241 AAGAATAGAAGGAGAGGAGTTGG + Intronic
991487968 5:67157621-67157643 CAGGAGAGATGGAGAGGACTGGG + Intronic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
993495096 5:88599974-88599996 CAGGGAAGGTGGAGAGGAGTGGG + Intergenic
993960062 5:94286867-94286889 CAGTAGAGAAGCAGAGGTGGGGG - Intronic
994607112 5:101982009-101982031 CGGTAGAGATGGAGATGAGCAGG + Intergenic
994681626 5:102894880-102894902 CAGTAGAGAAGGAGAAAAGAGGG - Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996211598 5:120817901-120817923 CAGCTGAGGTGTAGAGGAGTAGG - Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996772648 5:127101347-127101369 CAGTAGAATTAGAGAGGAGAAGG - Intergenic
997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG + Intergenic
997885813 5:137629055-137629077 CAGTACAGGAGGAGAGAAGTGGG - Intronic
998158937 5:139802214-139802236 AGGCAGAGAAGGAGAGGAGTTGG + Intronic
998350059 5:141494708-141494730 CGGGAGAGAAGGAGGGGAGTGGG - Intronic
998400691 5:141847359-141847381 GAGTAGAAATGGAGGGGAGTTGG - Intergenic
998973130 5:147614483-147614505 CAGTAGAGATAAAAAGAAGTAGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999783285 5:154868664-154868686 CAGCATAAATGGAAAGGAGTGGG - Intronic
999823945 5:155256340-155256362 CAGTTAAGATGAAGAGGGGTTGG + Intergenic
1000200917 5:159010208-159010230 CAGATGAGATGGAGATGAGTAGG + Intronic
1000452892 5:161412395-161412417 CAGTGGAGATGGTAAGGAATCGG - Intronic
1000970445 5:167708594-167708616 CAGAAGGGATGGAGAGGACTTGG + Intronic
1001004096 5:168034559-168034581 TAGTAGAGATGGCGGGGGGTGGG - Intronic
1001061733 5:168496457-168496479 AAGCAGAGAGGGAGAGAAGTGGG + Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1002706974 5:181168018-181168040 CAGTAGAGGTGGGGAGTAGGGGG - Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003742223 6:8953807-8953829 AAGTTCAGATGGAGTGGAGTGGG - Intergenic
1004180344 6:13375905-13375927 CTGTAGAGATGGAGATGTATGGG - Intronic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1006129306 6:31859811-31859833 CAGCATGGATGGAGAGGAGCAGG - Exonic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006948066 6:37798672-37798694 CAGGACAGATGGAAAGGAGTGGG - Intergenic
1007995756 6:46306115-46306137 CAGGGGATATGGTGAGGAGTAGG + Intronic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1009684373 6:66937014-66937036 CAGGAGAAATGGACCGGAGTGGG + Intergenic
1012225637 6:96700323-96700345 CAGTAGAGAGGTTGTGGAGTGGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012692792 6:102335633-102335655 CAGTAGATATTGAGCGGAGGTGG + Intergenic
1012868070 6:104641736-104641758 CAGAAGAGAAGTAGAAGAGTGGG + Intergenic
1013150666 6:107442822-107442844 CAGTAGTGATGGAGATGAAGTGG - Intronic
1013580021 6:111524493-111524515 AAGCAGAGATGGGGAGGAGGTGG - Intergenic
1013919160 6:115380280-115380302 CTGAAGAGAGGGAGAGTAGTGGG - Intergenic
1015342610 6:132119010-132119032 TAGGAGAAATGGAGAGGATTAGG + Intergenic
1015885072 6:137909594-137909616 GAGTAGAGGGGGAGAGGAGAGGG + Intergenic
1015910524 6:138164159-138164181 CAGTGGAAATGGACTGGAGTGGG - Intronic
1016292107 6:142537694-142537716 CAGTTGAGAGGGAGAGGTGGGGG - Intergenic
1016323747 6:142876525-142876547 CAGCAAAAATGGAGAGGAATAGG + Intronic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016912598 6:149214158-149214180 CAGTGAAGATGGAGAAGAGCAGG - Intergenic
1018956825 6:168415876-168415898 CACCAGGGATGGAAAGGAGTCGG + Intergenic
1019919318 7:4152969-4152991 CAGTAGAGAGGAAGAAGAGAAGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022353406 7:29587385-29587407 TAGTAGAGGTGCAGAGGTGTTGG - Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022729604 7:33010082-33010104 CAGGGAAGATGGAGAGGAATAGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023313051 7:38907342-38907364 CAGAAGGGAAGGAGAGTAGTGGG + Intronic
1023320383 7:38990896-38990918 CAGTAGACAAGGATACGAGTTGG + Intronic
1023398966 7:39777850-39777872 CAGTGAAGATGTGGAGGAGTTGG - Intergenic
1023728646 7:43169391-43169413 CAGTAGAAAGGGTGAGGGGTGGG - Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024651475 7:51406840-51406862 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1025133680 7:56392650-56392672 CAGTGAAGATGTGGAGGAGTTGG + Intergenic
1025159704 7:56645364-56645386 CAGGAGAGATCTAGAAGAGTGGG + Intergenic
1025887742 7:65614373-65614395 CAGAAGAGGGTGAGAGGAGTGGG - Intergenic
1025945145 7:66099378-66099400 GAGGAGAGAAGGAGAGGAGAAGG + Intronic
1025978131 7:66385759-66385781 CAGGAGAGAGGGAGAGAATTAGG - Intronic
1026055460 7:66979868-66979890 CAGAAGAGATGGAGAGTGGATGG - Intergenic
1026722239 7:72841958-72841980 CAGAAGAGATGGAGAGTGGATGG + Intergenic
1027306339 7:76901843-76901865 CACTAAAAATGGAGAGGAGGAGG + Intergenic
1028139043 7:87252144-87252166 AAGCAGACATGGAAAGGAGTGGG + Intergenic
1028447632 7:90943245-90943267 ACGTAGAGATGGAGAAGAGGTGG + Intronic
1028656149 7:93209603-93209625 TACTAGAGATGGGGAAGAGTGGG - Intronic
1028768606 7:94589341-94589363 CAATGGAGATGGGGAGGAATGGG - Intronic
1029433868 7:100550501-100550523 AAGAAGAGATGGTAAGGAGTAGG + Exonic
1030162024 7:106518647-106518669 AAGGAGAGAAGGAGAGGAGAGGG - Intergenic
1030475437 7:110026924-110026946 TAGTAGTGATAGGGAGGAGTGGG - Intergenic
1031069549 7:117146532-117146554 CAGCAGAGAAGCGGAGGAGTCGG + Intronic
1032552039 7:132793101-132793123 CAGGAGAAATGGAAAGGAGCGGG - Intronic
1032653457 7:133903411-133903433 CAGCAGAGATGGAGGGAACTGGG + Intronic
1032956294 7:136975418-136975440 CAGTAGAGAAGGACAGGGGAAGG + Intronic
1033028744 7:137804200-137804222 CAGTAGAGAGGGGGAAGAGATGG - Intronic
1033151106 7:138915688-138915710 CAGAAGAGGTAGGGAGGAGTGGG - Intronic
1033415623 7:141158938-141158960 AATTAGAGATGGAGAGGACAAGG + Intronic
1034606226 7:152318440-152318462 TAGTAGAGATGGGGAGGGGGTGG - Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035751158 8:1997349-1997371 TAAAATAGATGGAGAGGAGTTGG - Intronic
1036561784 8:9904880-9904902 GAGTGGAGATGGAGGTGAGTAGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037813133 8:22098318-22098340 CAGCAGAGATGGAGAGGTTGGGG + Intronic
1038324350 8:26561325-26561347 AGGTAAAGATGGAGAGGAGAGGG - Intronic
1039745985 8:40427780-40427802 GAATAGAGATAGAGAGGAGGTGG - Intergenic
1039965216 8:42279053-42279075 GAGTAGAGGTGGAGGGGAGCAGG + Intronic
1040440092 8:47432380-47432402 CAGTTGAGATGAAGGGGAGATGG + Intronic
1040747544 8:50663466-50663488 GAGGAGAGAGGCAGAGGAGTCGG + Intronic
1041487187 8:58392189-58392211 CAGAGAAGATGGGGAGGAGTAGG - Intergenic
1041609908 8:59833491-59833513 GAGTAGGGAGGGAGAGGAGGAGG + Intergenic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042275965 8:67005724-67005746 GCTTAGAGATGAAGAGGAGTGGG - Intronic
1042570880 8:70163326-70163348 CAGTAGAAATGTCAAGGAGTTGG - Intronic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044833889 8:96277311-96277333 TAGTGGAGATGGTGGGGAGTTGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044963879 8:97556905-97556927 CGGTGTAGAGGGAGAGGAGTGGG + Intergenic
1045064685 8:98435012-98435034 CAGTCCAGGTGGAGAGCAGTGGG - Intronic
1045187366 8:99852699-99852721 GAGCAGGGAAGGAGAGGAGTTGG + Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045497403 8:102719992-102720014 GAGAAGAGTTGGAGAAGAGTTGG - Intergenic
1045683503 8:104687826-104687848 CACCAGAGATGGAAAGGACTTGG - Intronic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046551878 8:115728428-115728450 CAGTAGAGATGGATTTCAGTGGG + Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1047984905 8:130222510-130222532 CAGTGGAGAAGGATAGGATTTGG - Intronic
1049032021 8:140045115-140045137 CAGCAGAGATGGAGAGGAAAAGG + Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050013158 9:1205959-1205981 CAGTAGAGAGGGAGGAGGGTAGG + Intergenic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050782606 9:9356604-9356626 AAGTAGTGATGGGGAGAAGTAGG + Intronic
1050820226 9:9869866-9869888 CAGCAGAGATTGAGACAAGTGGG + Intronic
1051907985 9:22118334-22118356 CTGTTGAGAGGGAGTGGAGTGGG - Intergenic
1052750471 9:32484622-32484644 CAGTAGAGATGGATTGGAGAAGG - Intronic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053281120 9:36820306-36820328 CAGCAGAGGAGGAGAGGAGCTGG - Intergenic
1054888936 9:70230970-70230992 CAGTCTAAATGGAGAAGAGTTGG - Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055124400 9:72702592-72702614 CAAGAGAGATGGAGAGAATTTGG + Intronic
1055346934 9:75349760-75349782 CAGTGGAGGTGGCGAGGGGTGGG + Intergenic
1056673396 9:88651347-88651369 GAGCAGAGATGGAAAGAAGTGGG + Intergenic
1056900589 9:90595923-90595945 AAGTAGAGAAGCAGGGGAGTGGG - Intergenic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1059070583 9:111131821-111131843 CAGCAGAAGTGGAGAGGAGGAGG + Intergenic
1059181116 9:112213304-112213326 CAGTAGAAAGGGAGAGGGGCAGG + Intergenic
1059208077 9:112485529-112485551 CTCTAGAGATGGAGAGGGGTTGG + Intronic
1059905285 9:118977141-118977163 TGGTAGAAATGAAGAGGAGTGGG + Intergenic
1059971373 9:119672325-119672347 CAGGAGAGGAGGAGAGGAGAAGG - Intergenic
1060222400 9:121771701-121771723 CAGGAAAGACGGAGAGCAGTGGG - Intronic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061279077 9:129586730-129586752 CAGTGGAGTTGGGTAGGAGTGGG + Intergenic
1185744401 X:2560478-2560500 CATGAAAGGTGGAGAGGAGTTGG - Intergenic
1185831098 X:3303767-3303789 CAGGAGACACGGAGAGGAGTAGG + Intergenic
1186658721 X:11645736-11645758 AAGAGGAGAAGGAGAGGAGTAGG + Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1188335665 X:28929417-28929439 CAGTAAGGAATGAGAGGAGTGGG - Intronic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190591496 X:52007181-52007203 CAGTAGAGGGGGCCAGGAGTTGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191141610 X:57121163-57121185 CAGGAGACATGGGGTGGAGTTGG - Intronic
1191143251 X:57137130-57137152 CAGGAGACATGGGGTGGAGTTGG - Intronic
1191711127 X:64150991-64151013 CAGGAGAGAGAGAGAGAAGTGGG + Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192571461 X:72209604-72209626 TAGTAGAGATGGAAAGAAGGTGG - Intronic
1192655495 X:72989070-72989092 TAGTAGAGATAGAGAGTACTTGG + Intergenic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195443432 X:104922452-104922474 CAACAGAGATGGAGAGGTGGAGG - Intronic
1196125546 X:112095042-112095064 TAGTAGAAAAGGAGAGGAGAAGG + Intergenic
1196468667 X:115999367-115999389 GAGTAGAGATGGAAGGGGGTAGG - Intergenic
1196830750 X:119773653-119773675 GATTCGGGATGGAGAGGAGTAGG + Intergenic
1196887574 X:120262638-120262660 CAGGAGGGAGGGAGAGGAGGAGG - Intronic
1197198838 X:123731882-123731904 TACTAGAAATGGAGAGGGGTGGG + Intronic
1197415784 X:126171057-126171079 TAGAAAATATGGAGAGGAGTAGG - Intergenic
1197795709 X:130296107-130296129 CAGTAGTGGTGGAGAGGAAGGGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198305909 X:135382943-135382965 TTGTAGTGATGGAGTGGAGTGGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199006003 X:142696381-142696403 CAGTAGAAATGGAAAAGATTAGG + Intergenic
1199226100 X:145376536-145376558 TAGTAGAGATGGAGACAAGGAGG + Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199991635 X:152990605-152990627 CATTCGAGATGAAGAAGAGTGGG - Exonic
1200088591 X:153623957-153623979 CAGGAGAGACAGAGAGGAGAAGG + Intergenic
1200103083 X:153698032-153698054 GAGAAGAGGTGGAGAGGAATTGG + Intergenic
1200945213 Y:8828811-8828833 TGGTAGAGATGGTGAGAAGTGGG + Intergenic