ID: 1049469344

View in Genome Browser
Species Human (GRCh38)
Location 8:142768530-142768552
Sequence CTTCCCTGCACCAGGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 375}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049469344_1049469355 5 Left 1049469344 8:142768530-142768552 CCAGGAGCCCTGGTGCAGGGAAG 0: 1
1: 0
2: 4
3: 38
4: 375
Right 1049469355 8:142768558-142768580 CTGGGTCAGAGGGGAGTCCGTGG No data
1049469344_1049469358 13 Left 1049469344 8:142768530-142768552 CCAGGAGCCCTGGTGCAGGGAAG 0: 1
1: 0
2: 4
3: 38
4: 375
Right 1049469358 8:142768566-142768588 GAGGGGAGTCCGTGGGCACCGGG No data
1049469344_1049469352 -5 Left 1049469344 8:142768530-142768552 CCAGGAGCCCTGGTGCAGGGAAG 0: 1
1: 0
2: 4
3: 38
4: 375
Right 1049469352 8:142768548-142768570 GGAAGGGCCTCTGGGTCAGAGGG No data
1049469344_1049469356 6 Left 1049469344 8:142768530-142768552 CCAGGAGCCCTGGTGCAGGGAAG 0: 1
1: 0
2: 4
3: 38
4: 375
Right 1049469356 8:142768559-142768581 TGGGTCAGAGGGGAGTCCGTGGG No data
1049469344_1049469351 -6 Left 1049469344 8:142768530-142768552 CCAGGAGCCCTGGTGCAGGGAAG 0: 1
1: 0
2: 4
3: 38
4: 375
Right 1049469351 8:142768547-142768569 GGGAAGGGCCTCTGGGTCAGAGG No data
1049469344_1049469359 21 Left 1049469344 8:142768530-142768552 CCAGGAGCCCTGGTGCAGGGAAG 0: 1
1: 0
2: 4
3: 38
4: 375
Right 1049469359 8:142768574-142768596 TCCGTGGGCACCGGGCACCCAGG No data
1049469344_1049469357 12 Left 1049469344 8:142768530-142768552 CCAGGAGCCCTGGTGCAGGGAAG 0: 1
1: 0
2: 4
3: 38
4: 375
Right 1049469357 8:142768565-142768587 AGAGGGGAGTCCGTGGGCACCGG No data
1049469344_1049469361 27 Left 1049469344 8:142768530-142768552 CCAGGAGCCCTGGTGCAGGGAAG 0: 1
1: 0
2: 4
3: 38
4: 375
Right 1049469361 8:142768580-142768602 GGCACCGGGCACCCAGGCAGAGG No data
1049469344_1049469353 -4 Left 1049469344 8:142768530-142768552 CCAGGAGCCCTGGTGCAGGGAAG 0: 1
1: 0
2: 4
3: 38
4: 375
Right 1049469353 8:142768549-142768571 GAAGGGCCTCTGGGTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049469344 Original CRISPR CTTCCCTGCACCAGGGCTCC TGG (reversed) Intronic
900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG + Intronic
900357241 1:2270863-2270885 CTCTCCTGCCCCAGGGCACCTGG + Intronic
900920549 1:5667676-5667698 CTCCCCTGCACCAGTGGTTCAGG + Intergenic
900929343 1:5726447-5726469 CTGGCCTGCAGCAAGGCTCCAGG + Intergenic
901490986 1:9596092-9596114 CTGCCCTGCCCCGGGGCTCATGG + Intronic
902125082 1:14202482-14202504 CTTCCCTGCACCCCAGCACCTGG - Intergenic
902405554 1:16181625-16181647 CTGACCTGCACCAGGCCTTCTGG + Intergenic
902797118 1:18807176-18807198 CTTCCCTCCTCCTGTGCTCCTGG - Intergenic
903161302 1:21491058-21491080 CTGCTCTGGCCCAGGGCTCCAGG - Intergenic
903273204 1:22204953-22204975 GTCCACTGCACCAGGACTCCTGG + Intergenic
904035607 1:27557078-27557100 CCTCCCTGGAACAGGGCACCTGG + Intronic
904323522 1:29712001-29712023 CTTCCCTGCCCCAAGATTCCAGG + Intergenic
906105318 1:43288292-43288314 GTTCACTGCATCAGAGCTCCTGG - Intergenic
906142285 1:43540821-43540843 CTTCCCTGGGTCAGGGGTCCTGG + Intronic
907471891 1:54679553-54679575 CTTCCCTGCCCCATGGCTTAGGG - Intronic
909887558 1:80961898-80961920 ATTCACTGCACCTGGGCTGCAGG - Intergenic
913058089 1:115180333-115180355 CAGCCCTGCACCAAGACTCCTGG + Intergenic
913089634 1:115467898-115467920 TTTCCCTGCCCCAGGTCCCCAGG + Intergenic
913331342 1:117670628-117670650 GTGCCCTGCACAAGGGCTCCTGG + Intergenic
913645409 1:120849928-120849950 ATGCCCTGCGCCAGGGCACCAGG + Intergenic
914350538 1:146835982-146836004 CTCTCCTGCAGCAGGGCTGCAGG + Intergenic
919976929 1:202618947-202618969 CTTCACTTCTCCAGGCCTCCAGG - Intronic
920055301 1:203186658-203186680 CTTCCCTTGCCCACGGCTCCTGG + Exonic
920311061 1:205048525-205048547 CACCCCTGCACCAGGGCAGCTGG + Intronic
921828414 1:219700129-219700151 CTGCCCTGCAGGAGAGCTCCAGG + Intronic
922513047 1:226186088-226186110 CATTCTTCCACCAGGGCTCCTGG + Intronic
922615443 1:226958534-226958556 CTGCCCTGGCCCAGGGCTCATGG - Intronic
922804358 1:228377923-228377945 CCTCCCAGCTCCAGAGCTCCTGG + Exonic
922863909 1:228842537-228842559 CTTCCCTGCTCCTGGGACCCTGG + Intergenic
922888617 1:229042139-229042161 CTCCGAGGCACCAGGGCTCCAGG + Intergenic
1062939958 10:1413620-1413642 CTTCCCTGCCCTAGGGTTCACGG - Intronic
1064035915 10:11913265-11913287 CATCCCTCCGCCAGGGCTGCGGG + Intergenic
1064042733 10:11982414-11982436 CTTGCCTGCACCAGGCCCACTGG + Intronic
1064202914 10:13299789-13299811 CTTCCCCGCTCCCCGGCTCCTGG + Intronic
1066404311 10:35104520-35104542 CTTCCCTACACCAAGGTTCTAGG - Intergenic
1067471134 10:46539118-46539140 CTTACCTTCCCCAGGACTCCTGG - Intergenic
1067582435 10:47454096-47454118 CTTCCATTCTCCAGTGCTCCCGG - Intergenic
1069598196 10:69686446-69686468 CCTCCACGCACCAGGGCACCAGG - Intronic
1069721674 10:70553790-70553812 TTTCCCTGCAGCAGGGCTCAAGG - Intronic
1069834994 10:71302638-71302660 GCTCCCTGCACCAAAGCTCCTGG - Exonic
1069847535 10:71383099-71383121 GTTCCAGGAACCAGGGCTCCTGG + Intergenic
1070349307 10:75576396-75576418 CCTCCCTGCAACAGGGCACCTGG + Intronic
1071289358 10:84177261-84177283 GTTCCCTGCACAGGGGCTGCAGG + Intronic
1071290560 10:84185833-84185855 ATTCCCTGGCCCAGGGCTCTGGG + Intergenic
1072223336 10:93346227-93346249 CTTCTCTGAATCAGGGATCCAGG + Intronic
1072533644 10:96343013-96343035 CTTCCCTAACCCAGGGCTGCTGG - Intergenic
1072971393 10:100020828-100020850 CTTTCCTGCCACAGGGCTCCTGG + Intergenic
1073452061 10:103616000-103616022 CTGATATGCACCAGGGCTCCGGG + Intronic
1073604422 10:104879757-104879779 CTGCCCTGAGCCAGGGCTCACGG + Intronic
1075567319 10:123514062-123514084 CTCCCCTTCCCCAGGACTCCAGG - Intergenic
1075608474 10:123833276-123833298 GTTCCCTACACCAGGGCGGCTGG - Intronic
1075619638 10:123916300-123916322 CTTCTCTATCCCAGGGCTCCTGG - Intronic
1075654410 10:124151932-124151954 CTACCCTGCACCACTGCCCCGGG + Intergenic
1076252995 10:128997717-128997739 GTTCCTTGGACAAGGGCTCCTGG - Intergenic
1076349745 10:129807883-129807905 CTGCCCTGGACCAGCGTTCCTGG + Intergenic
1076596383 10:131625210-131625232 GGTCCCTGCATCCGGGCTCCAGG - Intergenic
1076685461 10:132196624-132196646 CTTGCCTGCTCCTGTGCTCCGGG - Intronic
1076824349 10:132959685-132959707 CATGCCTGGACCAGGACTCCTGG + Intergenic
1076902637 10:133347516-133347538 CTCCCCTGAACCAGGCCCCCTGG - Intronic
1076987863 11:252525-252547 CATCCGTGCACCAGAACTCCAGG - Exonic
1077061777 11:620716-620738 CTTCCTGGCACCAAGGCACCTGG - Intronic
1077164482 11:1128976-1128998 CCTCCCGGCTCCAGAGCTCCAGG - Intergenic
1077310666 11:1887656-1887678 GTAGCCTGCAACAGGGCTCCAGG - Intronic
1077321191 11:1942854-1942876 CTGCTCTGCCCCAGGGATCCTGG + Intergenic
1077497880 11:2895318-2895340 CTTCCCTGCTCCAGGCACCCTGG - Intronic
1077998259 11:7472346-7472368 CTTCCCAGGCCCAGAGCTCCTGG - Intergenic
1078642923 11:13113278-13113300 CCTCCCTCCAACAGGGCTGCGGG - Intergenic
1081702001 11:45158202-45158224 CTGCCCTGTCCCAGGGCTGCTGG + Intronic
1082808374 11:57463897-57463919 CTTCACTGCCCCAGGCCTGCTGG - Intronic
1083689932 11:64401350-64401372 CTTCTCGGCACCAGGGCTTCTGG + Intergenic
1083791633 11:64989662-64989684 CTGCTCAGCTCCAGGGCTCCTGG - Exonic
1083857533 11:65400536-65400558 CTTCCCTGGACCACAGCCCCTGG + Intronic
1084113594 11:67028923-67028945 CCACCCTGCACCAGGCCTGCAGG + Intronic
1084455726 11:69267277-69267299 CTTCCCTGGACCAGGGGTTGGGG - Intergenic
1084657298 11:70527058-70527080 CTTCCCTGATCCTGGCCTCCAGG + Intronic
1085397146 11:76212269-76212291 CTCCCCTGCCCCAGGCCCCCCGG + Intergenic
1085451622 11:76637520-76637542 CTGTCCTGCACCAGGCCTCCAGG + Intergenic
1088095830 11:106100484-106100506 CTTCCCTGCCCCAGGATTGCTGG - Intergenic
1088600462 11:111469789-111469811 CTTCCCTGAAATAGGCCTCCAGG - Intronic
1089340204 11:117752172-117752194 CTTCCGTGCAAGAGGCCTCCTGG - Intronic
1089593567 11:119560477-119560499 CTGGCCTGCCCCAGGGCTCAGGG - Intergenic
1089612426 11:119677000-119677022 CTTCCCTGCCTAAAGGCTCCTGG + Intronic
1090686088 11:129121570-129121592 CTTCCATACTCCAGGCCTCCTGG + Intronic
1090831949 11:130426464-130426486 GTTCCCTGAAACAGGGATCCTGG - Intronic
1091037309 11:132245621-132245643 CTGCCCCGCACCAGGACTGCAGG - Intronic
1091311268 11:134576902-134576924 CCTCACTGCACCAGGCCTGCAGG + Intergenic
1092115190 12:5996068-5996090 CTGCCTTGCTCCAGGGCTGCAGG + Exonic
1092269790 12:7014411-7014433 TTTGCCAGCACCAGGGCTCATGG + Intronic
1092399692 12:8164240-8164262 TTCCCCAGCACCAGGGCCCCTGG + Intronic
1092404812 12:8212751-8212773 CTTACCTGCACCACAGCTCCTGG + Intergenic
1094293796 12:28881145-28881167 CTTGCCTGCAGGAGGGCTGCTGG + Intergenic
1096466793 12:51851115-51851137 CCACCCTGCACCAGTGCTCAGGG + Intergenic
1096478350 12:51922361-51922383 CTTCTCTGCCCCAGGACTGCAGG + Intronic
1096478397 12:51922598-51922620 CTTCCCTGCACCCAGGGACCAGG - Intronic
1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG + Intergenic
1097938361 12:65278429-65278451 CTCCTCTGCCCCAGGGCTGCCGG - Intergenic
1098462143 12:70743577-70743599 ATTCTCTCCACAAGGGCTCCAGG - Intronic
1099657784 12:85517135-85517157 CTTCCCTCCATCATGGCTACTGG - Intergenic
1101430639 12:104624040-104624062 CTTCCCTCCATCAAGGCTGCAGG - Intronic
1101461224 12:104896968-104896990 CTTTCCTGCTCCAGGGCTTCAGG + Intronic
1101672587 12:106889987-106890009 AGTCCCTGCACCAGGTCTCCAGG + Intergenic
1102111770 12:110370710-110370732 CCTCCCTGCCCCAGGGCAGCAGG - Intergenic
1102254899 12:111409787-111409809 CATCCCTCTACCAGGGCTCCAGG + Intronic
1103504368 12:121431741-121431763 CTTTCCAGCACCACTGCTCCAGG - Intronic
1103986811 12:124772857-124772879 CTTCCCTGTCTCAGGACTCCTGG - Intergenic
1104018766 12:124977632-124977654 CTCTCCTGGACCATGGCTCCTGG - Intronic
1104796242 12:131521471-131521493 CTTCCCTGCAACAAGGCAGCGGG + Intergenic
1104803678 12:131571535-131571557 CCTCCCCACACCAGGACTCCTGG + Intergenic
1105243685 13:18628926-18628948 CTCCCCTGCACCTAGGGTCCGGG - Intergenic
1105326991 13:19379844-19379866 ATTCCCAGCACCAGTGCACCAGG + Intergenic
1105946647 13:25196113-25196135 GTTCTCTACACCTGGGCTCCAGG + Intergenic
1107162214 13:37243947-37243969 CTTCCCTGCATTAGGCCTTCAGG - Intergenic
1110501097 13:76229630-76229652 CTTCCATGTACGAGGGCTTCAGG - Intergenic
1112326594 13:98446009-98446031 TCTCCCTGCACCAGGGCCCTGGG - Intronic
1114455268 14:22849722-22849744 CTCCCCTTCTCCAGGGCTCCTGG + Intergenic
1114679608 14:24473436-24473458 GCCCCCTGCTCCAGGGCTCCTGG + Intergenic
1115284310 14:31700879-31700901 GCCCCCTGCTCCAGGGCTCCCGG + Intronic
1117012426 14:51484546-51484568 CTTCTCTACAGCAGGGTTCCAGG - Intergenic
1117321242 14:54625373-54625395 CTTCCCTGCACCAGGGTGTGAGG + Intronic
1117821897 14:59658276-59658298 GTTCCCTGCAACAGAGCACCTGG + Intronic
1119001870 14:70889644-70889666 CTGCCTTGCTCCTGGGCTCCTGG - Intergenic
1119147807 14:72332599-72332621 GTTCCCTGCACCAGGGTACAGGG - Intronic
1119823991 14:77641984-77642006 CTTCCCTGCACGAGGGAGCGGGG - Intergenic
1120881188 14:89416697-89416719 CTTCCCGGCTCGGGGGCTCCCGG + Intronic
1122018843 14:98819858-98819880 CTTCCCTCCTCCAGGGGTTCAGG - Intergenic
1122216477 14:100208197-100208219 GTCCCCTGCTCCAGGGCGCCCGG - Intergenic
1122370021 14:101224539-101224561 CTTCCCTGACCCCGAGCTCCCGG - Intergenic
1122623178 14:103071166-103071188 CTTCCCTGCTGCATGGCGCCGGG + Intergenic
1122655718 14:103258257-103258279 CTTCTCTGTCCCTGGGCTCCTGG + Intergenic
1122879437 14:104683444-104683466 CCTCCCTGCCCCACGGCTCCAGG - Intergenic
1122901567 14:104784320-104784342 CATCCATGGCCCAGGGCTCCAGG + Intronic
1123632526 15:22271996-22272018 CTTCACTGCACCCCGACTCCCGG + Intergenic
1123996466 15:25721214-25721236 CTTCCCTGGAACAGTGTTCCTGG - Intronic
1125584067 15:40807875-40807897 CTTCCCTCCCCGAGGGCTGCAGG + Intronic
1125591069 15:40854702-40854724 CTGCCCTGATCCAGGGCACCTGG - Intronic
1128756128 15:70185250-70185272 CTTAGATGCACCAGGTCTCCAGG - Intergenic
1130520588 15:84658187-84658209 CTTCCCGGCCGCTGGGCTCCGGG + Exonic
1132178537 15:99733835-99733857 CTTCCCCGCAGGAGGGCTCAGGG - Intergenic
1132289102 15:100686801-100686823 CTGCTCCCCACCAGGGCTCCTGG - Intergenic
1132580477 16:682504-682526 CTCCCCTGGACCAGGACGCCAGG - Exonic
1132866936 16:2097687-2097709 GTGACCTGCACCAGGGCTCGAGG + Intronic
1132881153 16:2162279-2162301 GTTCCCTGCACCTGAGCTCCTGG - Intronic
1132976114 16:2711957-2711979 CTTTCCTGCTCCACTGCTCCTGG - Intergenic
1133256181 16:4517834-4517856 CTCCCCTGCAGGAGGGCACCTGG - Intronic
1133613762 16:7456812-7456834 CAGCCCTGCTCCAGGGCTCAGGG - Intronic
1134524831 16:14935416-14935438 GTGACCTGCACCAGGGCTCGAGG - Intronic
1134548066 16:15125509-15125531 GTGACCTGCACCAGGGCTCGAGG + Intronic
1134712420 16:16333903-16333925 GTGACCTGCACCAGGGCTCGAGG - Intergenic
1134720286 16:16377215-16377237 GTGACCTGCACCAGGGCTCGAGG - Intergenic
1134947141 16:18334670-18334692 GTGACCTGCACCAGGGCTCGAGG + Intronic
1134954407 16:18374791-18374813 GTGACCTGCACCAGGGCTCGAGG + Intergenic
1135146064 16:19963737-19963759 CTTCCTTGCACCTGGGCGGCTGG + Intergenic
1136170871 16:28488545-28488567 CTTGCCTGACCCAGGGCCCCTGG - Intronic
1137539249 16:49350636-49350658 CTCCCCAGCACCAGAGGTCCCGG + Intergenic
1137717354 16:50606392-50606414 CGTCCATGAACCATGGCTCCGGG + Intronic
1138250326 16:55497102-55497124 GGGCTCTGCACCAGGGCTCCTGG + Intronic
1138433330 16:56983312-56983334 GTCCCCTGCCCCAGGGCTCGAGG + Exonic
1141657163 16:85422420-85422442 CTCCCATCCACCAGGCCTCCGGG - Intergenic
1141664604 16:85459418-85459440 GTTCACTGCACAAGAGCTCCTGG - Intergenic
1141801368 16:86311600-86311622 CTTCCCAGGCCCAGGGCTCTGGG + Intergenic
1141895301 16:86955360-86955382 CGCCCCAGCACCAGGCCTCCTGG + Intergenic
1143183262 17:4997133-4997155 CTTCCCTCCAGCGGGGCTCCAGG - Intronic
1143527662 17:7481923-7481945 CTGCCCTGCCCCAGGTCGCCTGG + Intronic
1143779886 17:9223852-9223874 CTTCCCTGCACAAGGCCTAGGGG + Intronic
1144256670 17:13475237-13475259 CATCCCTGCACTAGAGCTCAGGG - Intergenic
1144639935 17:16931592-16931614 CTTCCCAGCACCACCACTCCTGG + Intronic
1144762999 17:17717843-17717865 CTTCACTGGACATGGGCTCCAGG - Intronic
1144872231 17:18378378-18378400 ATGCCCTGCACCCAGGCTCCAGG - Intronic
1145274955 17:21423691-21423713 CTGCCCTGCAGCAGGGTCCCAGG - Intergenic
1145312809 17:21709591-21709613 CTGCCCTGCAGCAGGGTCCCAGG - Intergenic
1146277303 17:31523875-31523897 CTTACCTGCAGCAGGGGGCCGGG - Exonic
1147171042 17:38619017-38619039 CTACCCAGATCCAGGGCTCCAGG + Intergenic
1148558645 17:48593421-48593443 CTTGCCTGAAGCGGGGCTCCTGG + Exonic
1149547915 17:57518144-57518166 GTTCCCTGCACTGGGGCCCCTGG + Intronic
1150697265 17:67416621-67416643 CATCCCTGCACCTGGGAACCAGG - Intronic
1151309154 17:73282873-73282895 GTTCCGTGCACCAGGACACCAGG + Intergenic
1151429565 17:74053210-74053232 CTGTCCCTCACCAGGGCTCCCGG - Intergenic
1151705453 17:75764828-75764850 CTTCCGTGCACCGGTGCTCCAGG + Intronic
1151768844 17:76146515-76146537 CTTCCCTACCCCAGGGAGCCAGG - Intronic
1152252354 17:79218656-79218678 CCTCCCTGCATCTCGGCTCCCGG - Intronic
1153492624 18:5665054-5665076 CTTCCCTGCACAGGGGATTCAGG - Intergenic
1153871627 18:9326203-9326225 GTTCCCTGCAGCAGGCCACCAGG - Intergenic
1154171551 18:12056572-12056594 CCTCCCTGCCCCAGTGCTTCTGG + Intergenic
1154445257 18:14430959-14430981 CTCCCCTGCACCTAGGGTCCGGG + Intergenic
1155182047 18:23356372-23356394 CTTCCATGGGCCAGGGGTCCTGG + Intronic
1156451068 18:37266772-37266794 CTTCCCTAGCCCAGGGCTCTTGG + Intronic
1157560298 18:48640722-48640744 ATGCCCTGCACCAGGGCCCAGGG + Intronic
1157662742 18:49460240-49460262 CTTCCCTGCCCGCGGGCGCCTGG - Intronic
1159071342 18:63626752-63626774 CTTCCATGAACCCAGGCTCCAGG + Intergenic
1160231588 18:77053228-77053250 CTTCCCTGCACCTGTCCTCATGG + Intronic
1160418239 18:78726764-78726786 CTCGCCTTCCCCAGGGCTCCAGG - Intergenic
1160779048 19:869703-869725 CTTCCCCGGAGCAGGGCTGCTGG + Intronic
1160805217 19:989624-989646 CTGCCCTGCCCCAGGACTGCGGG - Intronic
1160870800 19:1276937-1276959 CTCCCCTGCGCCAGGACCCCAGG - Intronic
1160913658 19:1486912-1486934 CTTCGCTGTACCAGGGCACGCGG + Exonic
1160993986 19:1873431-1873453 CTGCCCTCCCCCCGGGCTCCGGG + Intergenic
1161087310 19:2341056-2341078 CTCGGGTGCACCAGGGCTCCTGG + Exonic
1161705478 19:5818898-5818920 CTGCCCTCCACCAGAGCTCTAGG + Intergenic
1161766784 19:6212839-6212861 CAGCCCGGCCCCAGGGCTCCTGG + Intergenic
1163711625 19:18850626-18850648 CCTCCCTGCTCCGGGGCTTCAGG + Intronic
1163740723 19:19010125-19010147 CCTCCGTGCTCAAGGGCTCCGGG - Exonic
1165108000 19:33485887-33485909 CTGCCCCGGCCCAGGGCTCCTGG + Intronic
1165204003 19:34168551-34168573 CTTCCCTGCTTAAGAGCTCCCGG + Intergenic
1165782882 19:38444059-38444081 TCTCCCTCCACCAGGCCTCCCGG - Intronic
1168056202 19:53866581-53866603 CTTCCCTGCCCTGGGGCTTCGGG + Intronic
1168140740 19:54385122-54385144 CTTGCCAGCACCACGGCGCCAGG + Intergenic
1168157662 19:54485266-54485288 CTTGCCAGCACCACGGCGCCAGG - Intergenic
925886990 2:8401771-8401793 TCTCCCTGCACCAGGCCTGCAGG + Intergenic
926224181 2:10955567-10955589 CTGCCCTGCACCTGGGCTCCAGG + Intergenic
926324260 2:11770826-11770848 CCTGCCTGCACCAGGGCCCAAGG - Intronic
927102601 2:19799526-19799548 ATTCCCTGTTCCAGGGCTGCAGG - Intergenic
927429912 2:23018823-23018845 CTTCCAGAAACCAGGGCTCCTGG - Intergenic
927708317 2:25310578-25310600 CCTCCCTGATCCTGGGCTCCGGG + Intronic
928102271 2:28445961-28445983 CGGACCTGCACCAGGGGTCCAGG - Intergenic
931460884 2:62449046-62449068 TGTCCCAGCACCAGAGCTCCAGG + Intergenic
932568533 2:72924525-72924547 CTCACCTCCACCCGGGCTCCGGG - Intronic
932737148 2:74262198-74262220 CGGGCCAGCACCAGGGCTCCGGG + Exonic
933793505 2:85902396-85902418 CTCCCCTTCCCCAGGACTCCCGG + Intergenic
933944954 2:87278284-87278306 CCTCCCTGCTCCAGGTCTCTGGG - Intergenic
935739773 2:106137367-106137389 CTTCCAAGCTCCAGGGCTGCAGG + Intronic
936098235 2:109550756-109550778 ATTCCCTCAACCAGGGCTCTCGG + Intronic
936509377 2:113132930-113132952 TCCCCCTGCCCCAGGGCTCCCGG + Exonic
936707898 2:115098036-115098058 CATTCCAGCACCAGAGCTCCTGG - Intronic
938103176 2:128512189-128512211 CTTGTCAGCACCAAGGCTCCAGG + Intergenic
938249462 2:129802803-129802825 CTCCCCTCCCCCAGGCCTCCAGG - Intergenic
940816676 2:158304825-158304847 CTTACCTGCAGCAGAGCACCTGG + Intronic
941318418 2:164024163-164024185 CTACCCAGCTCCCGGGCTCCAGG - Intergenic
942078427 2:172378852-172378874 ATTCCATGCACCAGGGCTTGAGG - Intergenic
944802858 2:203253360-203253382 CTCCCCTGGCCCAGGGCTCCGGG + Intronic
945134717 2:206614960-206614982 TTTCCCTGCCCCAGCGCCCCAGG + Intronic
946372850 2:219290964-219290986 CTCCCCTCCCCCAGGCCTCCAGG - Intronic
947114758 2:226757243-226757265 ATGCCCAGAACCAGGGCTCCAGG - Intronic
947168062 2:227282673-227282695 TTTCCCTGCACCATGGCCCCTGG - Intronic
947715358 2:232336379-232336401 CATCCCTGCAGCAGGACCCCTGG - Intronic
947751280 2:232533994-232534016 CTCCTCCGCACCAGGGCCCCAGG - Exonic
948047487 2:234954901-234954923 CGTCCCTGGACCCTGGCTCCAGG + Intronic
948870250 2:240794174-240794196 CTTCCCTGCGCCAGGCCTAGGGG + Intronic
948948917 2:241236407-241236429 CTTCCCTTCACCAAGGCTCGGGG - Intronic
1169329355 20:4704452-4704474 TCTGCCTGCAGCAGGGCTCCTGG + Intergenic
1169403324 20:5302432-5302454 CTGCCTTGAACCAGAGCTCCCGG + Exonic
1170460292 20:16571434-16571456 CCTCCATGTACCTGGGCTCCAGG + Intronic
1172845590 20:37928191-37928213 CTGCCCAGCAGCAGGGCACCAGG - Intronic
1176111219 20:63411597-63411619 CCTTCCTCCACCAGGGCCCCAGG - Intronic
1176155799 20:63619757-63619779 CTTCCCTGGACGCAGGCTCCCGG + Exonic
1176289601 21:5037115-5037137 CCTGCCTGCCCCAGGGCTCAGGG + Intronic
1178954479 21:37010155-37010177 GTGACCTGTACCAGGGCTCCCGG + Intronic
1179867629 21:44226472-44226494 CCTGCCTGCCCCAGGGCTCAGGG - Intronic
1179884046 21:44305945-44305967 CTGCCCTGCCCCAGGGCCTCAGG - Intronic
1180032981 21:45224663-45224685 CTGCCCCGGCCCAGGGCTCCCGG - Exonic
1180052178 21:45336209-45336231 TCTCCCTGCACTAAGGCTCCAGG - Intergenic
1180058827 21:45374457-45374479 GTTCCCTCCACCAGAGCTCCTGG - Intergenic
1180976993 22:19854029-19854051 CTTCCCTGCACCAGCCAGCCAGG + Intronic
1181028951 22:20140853-20140875 CGTACCTGCACCAGGGCACAGGG - Exonic
1181329296 22:22076728-22076750 CTTTCCTGCACCTGGGCTGAAGG + Intergenic
1181407368 22:22694510-22694532 CTGCCCAGCCCCAGGCCTCCAGG + Intergenic
1181415366 22:22755277-22755299 CTGCCCAGCCCCAGGCCTCCAGG + Intronic
1182520113 22:30880398-30880420 TATCCCTGCACCAGGGGTGCTGG + Intronic
1182688193 22:32136914-32136936 CTTTCCTGCACCACAGCTGCAGG - Intergenic
1183311687 22:37113227-37113249 CATCCCCTCACCAGGCCTCCCGG - Intergenic
1183357108 22:37365445-37365467 CTTCCCCGCAGCAGGGCTCCAGG - Intergenic
1183383150 22:37500508-37500530 CCTCCCGGCACCCAGGCTCCAGG + Intronic
1183408329 22:37641029-37641051 CTTCCCCGCAGCAGGGCACCTGG - Intronic
1184264224 22:43338293-43338315 CTGCCCTGCACCTGGGGTGCTGG - Intronic
1184296346 22:43527706-43527728 CTCCCCTCCACCTGGGCCCCAGG - Intergenic
1184339259 22:43877059-43877081 CATAGCTGCTCCAGGGCTCCAGG + Intergenic
1184500794 22:44870400-44870422 CCTCACTGCTTCAGGGCTCCAGG + Intergenic
1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG + Intronic
1185110434 22:48897503-48897525 CTTCTCCGGAGCAGGGCTCCCGG + Intergenic
1185129651 22:49031909-49031931 CTTCCCTGCTCCAGCCCTCGAGG + Intergenic
950089891 3:10288085-10288107 CTTGCCTGCACCACAGCGCCAGG - Intronic
950158607 3:10742480-10742502 CTTCCCTGAACCCTGGCCCCAGG - Intergenic
950406609 3:12808948-12808970 CACCCCTGCCCCATGGCTCCTGG - Intronic
950487603 3:13282472-13282494 GTTCCCTGGAAAAGGGCTCCAGG - Intergenic
950538820 3:13597820-13597842 CTTCACAGCATCAGGGCTCCGGG - Intronic
953774175 3:45801457-45801479 CTTCCCTGCCCCCGGGCCCTGGG + Intergenic
954137706 3:48589637-48589659 ATTACCTGGACCAGGGTTCCTGG - Exonic
954554764 3:51509142-51509164 TTTCCCTGCAACAAGGCTCACGG - Intergenic
954877246 3:53810156-53810178 CGTCCCTGCACCGCAGCTCCTGG + Exonic
954877500 3:53811727-53811749 CTCCCATGTACCAGGGCACCAGG + Exonic
955117209 3:56017578-56017600 TCTCCCTCCACAAGGGCTCCTGG + Intronic
956814815 3:72898627-72898649 GTTCCCTGCACCCGAGCACCCGG + Intronic
959105742 3:102062978-102063000 CTTCCCTGCAGCAGGGACACTGG + Intergenic
959667984 3:108942837-108942859 CTTCCCTCCTCCATGCCTCCAGG + Intronic
959726501 3:109548822-109548844 CTTCCCTGTACCAGACATCCAGG + Intergenic
960120837 3:113947793-113947815 CTTCCCGGCGCCAGGGCCGCGGG + Intergenic
960465977 3:117997124-117997146 CCTCCCTGCCGCCGGGCTCCGGG - Intergenic
961654431 3:128433393-128433415 AGCCCCTGCTCCAGGGCTCCAGG - Intergenic
962164903 3:133038542-133038564 CCTCCCTGAAGCTGGGCTCCCGG - Intronic
962961361 3:140314345-140314367 CTTCCCTGTCCCAGGGGTCTTGG - Intronic
963079360 3:141376712-141376734 CTTTCCTGGCCCAGGGGTCCAGG - Intronic
968500186 4:946287-946309 CTTCCCTGCTCCGGGGCACCTGG + Intronic
968609945 4:1552384-1552406 CTGCCCTGGGCCTGGGCTCCAGG - Intergenic
968801226 4:2744393-2744415 CTTTGCTGCACCAGGTGTCCTGG - Exonic
968871687 4:3245826-3245848 CCACCCTACACCAGGCCTCCAGG + Intronic
969330901 4:6472882-6472904 CTTCCCAGCACCCCGGCTCTTGG - Intronic
969612938 4:8237149-8237171 CTCCTGGGCACCAGGGCTCCAGG - Intronic
969716405 4:8870328-8870350 CTTCCCCTCCCCAGGGTTCCAGG - Intronic
969761315 4:9185265-9185287 CTTACCTGCACCACAGCTCCTGG - Intergenic
975165311 4:71172025-71172047 CTTCCCTGGACTAGGACACCAGG + Intergenic
975610177 4:76195615-76195637 CTTCCCAGGAGCAAGGCTCCAGG - Intronic
977569158 4:98611940-98611962 GTTCCCTACACAAGGGCTCCTGG - Intronic
979609066 4:122670542-122670564 CCCCCCTGCTCCACGGCTCCTGG + Intergenic
980994035 4:139763460-139763482 GTTCCCTGCACCAGGGCTTCTGG + Intronic
981788442 4:148507181-148507203 CTCCTATGCACCCGGGCTCCCGG - Intergenic
982069837 4:151685563-151685585 TGTTCCTGCACCTGGGCTCCAGG + Intronic
982155399 4:152515318-152515340 CTTCCCTGCACCCTCGCTTCAGG - Intronic
983040007 4:162914336-162914358 CTTCCCTGTACCACAGCTGCAGG - Intergenic
984947927 4:184984148-184984170 CTTCCCCGCACCTGCACTCCGGG + Intergenic
985173444 4:187176557-187176579 CCTCCAAGCACCAGGGCTCCAGG - Intergenic
985489437 5:170848-170870 ATCCCCAACACCAGGGCTCCAGG - Intronic
987011675 5:13772429-13772451 CTTTCCTGCACCAGAGATCCTGG - Intronic
987416115 5:17663509-17663531 CTTCCCTCCACCGGGGGTGCGGG + Intergenic
988593289 5:32567808-32567830 CCTCCCTGCAACAGGCCTGCAGG - Intronic
992826135 5:80552090-80552112 CATCCCTGCATGTGGGCTCCAGG - Intergenic
994346718 5:98696454-98696476 CCTCCCTGGGACAGGGCTCCAGG - Intergenic
995854161 5:116575038-116575060 CTTCCTTCCACCAGGATTCCTGG + Intergenic
997460796 5:134051027-134051049 GTGCCCTGCACAAGGGCACCTGG + Intergenic
998107652 5:139478500-139478522 CTTCCCTGCCTCAGAGCTCCAGG - Exonic
999366596 5:151027610-151027632 CTCCCCTGCTCCTGGGCTCTTGG + Intronic
999921538 5:156326880-156326902 CTCCCCTGCAACAGCGCTCATGG - Exonic
1002043525 5:176530259-176530281 CTGACTTGCACCTGGGCTCCGGG - Intronic
1002043542 5:176530307-176530329 CTGACTTGCACCTGGGCTCCGGG - Intronic
1002043575 5:176530403-176530425 CTGACTTGCACCTGGGCTCCGGG - Intronic
1002947347 6:1775635-1775657 ATGCCCTGCTCCAGGGATCCAGG + Intronic
1005376257 6:25185653-25185675 CTTCCCTGCGACAGAGCACCTGG - Intergenic
1006786659 6:36672318-36672340 CATCCCAGCTCCAGGGCTCCTGG + Intergenic
1007281237 6:40713878-40713900 CTTCCCTCCTGCAGGTCTCCAGG - Intergenic
1007335269 6:41150965-41150987 TGTCACTGCTCCAGGGCTCCTGG - Intronic
1007422699 6:41729106-41729128 CTCCCCTGCAGCAGGGCTGTGGG + Intronic
1007634129 6:43287753-43287775 ATTCTCTCCACCAGGCCTCCAGG + Exonic
1007696540 6:43737446-43737468 CTCCCCTGGAGCAGGGCTGCTGG - Intergenic
1007781263 6:44256341-44256363 CTTCTGTGCCACAGGGCTCCAGG - Exonic
1007913371 6:45537756-45537778 CATTCCTGCACCAGGGCTTCAGG + Intronic
1009011988 6:57853953-57853975 CTGCCCGGCTCCAGGGCTGCGGG - Intergenic
1011227013 6:85118723-85118745 CTTCCCTACACCATGGGTTCAGG + Intergenic
1011260444 6:85464860-85464882 CTCCACCGCACCAGGGCTTCTGG + Intronic
1011278139 6:85649723-85649745 CTTCCCTTCCCCCGAGCTCCTGG - Intergenic
1014999017 6:128191387-128191409 CTGCCCTGCCCCGGTGCTCCTGG - Intronic
1016843369 6:148546033-148546055 TATCTCTGCACCAGGGCTTCAGG - Exonic
1018472117 6:164106473-164106495 CTGCCCTGCATCGGGGCTGCGGG + Intergenic
1018623352 6:165752414-165752436 CTGCACTGAACCTGGGCTCCTGG + Intronic
1018641331 6:165907203-165907225 CTGCACTGCACCAGGACTCTGGG - Intronic
1018994606 6:168701406-168701428 CTGCCCACAACCAGGGCTCCAGG - Intergenic
1019041677 6:169111051-169111073 CTTCCCTTCTCCAGTGCCCCTGG + Intergenic
1019064202 6:169282208-169282230 CTTCCCTGCACCGGGGATGCTGG - Intergenic
1019155260 6:170034270-170034292 CAACCCTGCCCGAGGGCTCCTGG + Intergenic
1019460188 7:1154112-1154134 CTCCACTGTCCCAGGGCTCCTGG - Intronic
1019551027 7:1602606-1602628 CGGCCCCGCACCTGGGCTCCGGG + Intergenic
1019818016 7:3215578-3215600 GTTCCCGGCACCAGGTCTACAGG - Intergenic
1020078516 7:5274249-5274271 CTGCCGGGCACCACGGCTCCAGG + Intergenic
1020271687 7:6600364-6600386 CCTCCCTGGCCCAGGCCTCCTGG + Intronic
1022141810 7:27499487-27499509 CTTCAGGGCTCCAGGGCTCCAGG - Intergenic
1022486314 7:30781017-30781039 CATCCATGCAGCAGGACTCCAGG - Intronic
1025200376 7:56957944-56957966 CTGCCGGGCACCACGGCTCCAGG - Intergenic
1025671567 7:63618988-63619010 CTGCCGGGCACCACGGCTCCAGG + Intergenic
1025942194 7:66082765-66082787 CCTCCATACCCCAGGGCTCCGGG - Intronic
1026000736 7:66557817-66557839 CTCCCCTCAACCAGGGCACCAGG + Intergenic
1027984691 7:85272339-85272361 CTTCCCTGCTCCATTGCTCAGGG - Intergenic
1029355608 7:100049547-100049569 CCTCCCTGCCCCAGGGCGTCGGG + Intergenic
1029535427 7:101154805-101154827 CTTCCCTGCAGCGGGGATCGAGG - Intronic
1029604244 7:101589127-101589149 CTTCCCTGCACCCGGCGTCCTGG + Intergenic
1032479379 7:132234309-132234331 CTCCCCTGCACCAAGCCTACTGG - Intronic
1032800928 7:135316838-135316860 CTTCCCTGGAGCATGGCTGCCGG - Intergenic
1034266450 7:149783385-149783407 CTGCCCTCCACCTGGGCTCTTGG + Intergenic
1034474696 7:151275645-151275667 CCTCCATGCCCCTGGGCTCCAGG - Intronic
1035650497 8:1260574-1260596 CATCCCTGAGCCAGGACTCCGGG - Intergenic
1035650520 8:1260705-1260727 CATCCCTGAGCCAGGACTCCGGG - Intergenic
1035670004 8:1409798-1409820 CTGCCCTCCACCAGAGCCCCAGG + Intergenic
1035675326 8:1451869-1451891 GTTCCCTCCACCAGAGCTCACGG + Intergenic
1036197529 8:6733355-6733377 CCTCCCCTCACCAGGGGTCCTGG + Intronic
1036343697 8:7940594-7940616 TTCCCCAGCACCAGGGCCCCTGG + Intronic
1036845207 8:12163777-12163799 CTTACCTGCACCACAGCTCCTGG + Intergenic
1036866576 8:12406100-12406122 CTTACCTGCACCACAGCTCCTGG + Intergenic
1037667060 8:20978882-20978904 CATCTCTGCACCCTGGCTCCCGG - Intergenic
1039558770 8:38496258-38496280 CTTCCCAGCACCAGGACCACAGG - Intergenic
1039904180 8:41774108-41774130 CTTCCCTGCCCAGGGGGTCCTGG - Intronic
1040902237 8:52428833-52428855 CTTCCCTGCCCCAGGGCTGGAGG + Intronic
1040952954 8:52954227-52954249 GATCCCTGCACCAGGGCCGCAGG - Intergenic
1041313720 8:56540836-56540858 CTTCCCTGCAGCTGAGCACCAGG + Intergenic
1041349719 8:56936172-56936194 CTTTCCTTCACCAGGGATACAGG - Intergenic
1041693057 8:60708528-60708550 CTTCCCTTCACCTGGGATGCAGG + Intronic
1042855426 8:73261872-73261894 CTTCCCTGCAGCAAGGCTCCAGG + Intergenic
1044725533 8:95191549-95191571 CTTCCCTCCCCCTGGCCTCCAGG + Intergenic
1045406113 8:101868324-101868346 CTTCCAGGTACCAGGGATCCCGG + Intronic
1047703941 8:127478709-127478731 CTTTCCTCCTCCAGGGCTCCAGG + Intergenic
1047726875 8:127691543-127691565 CTTCCCTGCCCCACAGCTGCAGG + Intergenic
1047761304 8:127956423-127956445 CTTCCCTTCACCACGGAACCTGG - Intergenic
1048260522 8:132941239-132941261 CTTAGCTGCAACAGTGCTCCAGG - Intronic
1048899051 8:139020709-139020731 CATTCATGCACCAGGGCTACTGG + Intergenic
1049199301 8:141332056-141332078 CTTCCCGGCAGCAGGTCACCAGG - Intergenic
1049384916 8:142338332-142338354 CTTCACTGAACCAGGTCTCAAGG + Intronic
1049469344 8:142768530-142768552 CTTCCCTGCACCAGGGCTCCTGG - Intronic
1049643500 8:143726005-143726027 TTCCCCTGCCCCAGGGCTGCTGG + Exonic
1051380391 9:16452074-16452096 CCTCCCTGCACCATTGGTCCTGG - Intronic
1051723520 9:20064903-20064925 CTTCCCTGCCCCAGGGTGACTGG - Intergenic
1053054267 9:34984940-34984962 GTACCCTGCACCAGCTCTCCTGG + Intergenic
1055577170 9:77671704-77671726 CTCCCCTGCACCCTGACTCCAGG - Intergenic
1057211650 9:93203914-93203936 CATCCCTCCCACAGGGCTCCTGG - Intronic
1057575665 9:96240489-96240511 CTTCCCTGCCCAACAGCTCCTGG + Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058721771 9:107770607-107770629 ATTCCCTGCCCAAAGGCTCCTGG + Intergenic
1060054867 9:120404604-120404626 CTTCCCTGCACCCGGGCCTTGGG - Intronic
1060936084 9:127517080-127517102 CGTCCCCGCTCCAGGGCCCCAGG + Intronic
1061512069 9:131067575-131067597 CTTCCCTCCTGCAGGGCTCTGGG - Intronic
1061616688 9:131784935-131784957 TTTCCCTTCCCCAGGGCTGCCGG - Intergenic
1061807039 9:133142420-133142442 CTTGCCTGCAGGAAGGCTCCGGG - Intronic
1061873128 9:133531227-133531249 CTTCTGGGCACCAGGACTCCTGG - Intergenic
1062017227 9:134296957-134296979 CTTCCCTGTTCCAGGGCTCGGGG + Intergenic
1062270172 9:135704667-135704689 CTTCCCAGCAGCTGTGCTCCAGG + Intronic
1186507947 X:10109202-10109224 CCTTCCTGCACCAGAGCCCCTGG - Intronic
1187210464 X:17225886-17225908 CCTCCCTGTACCAGGACTTCTGG - Intergenic
1189418058 X:40832115-40832137 CTTTGCTGCACCAGGTGTCCTGG - Intergenic
1192183347 X:68929834-68929856 CTTCCCAGCACCCTGGCTCCTGG - Intergenic
1192237157 X:69303279-69303301 CTGTCCTGCCCCAGGGTTCCAGG + Intergenic
1198095224 X:133373601-133373623 TTTCCCATCACCAGGGCTCAGGG + Intronic
1198101393 X:133425203-133425225 CTTCACTCTCCCAGGGCTCCAGG + Intergenic
1200060255 X:153480835-153480857 CTTCCCTGCCCCAGCCCTCATGG - Intronic
1200123229 X:153800997-153801019 CTTCCCTGCAGCGGGACTCCAGG + Intergenic