ID: 1049471620

View in Genome Browser
Species Human (GRCh38)
Location 8:142777383-142777405
Sequence GGCTTGGTGAGTAGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049471620_1049471627 15 Left 1049471620 8:142777383-142777405 CCTCCTGGGCTACTCACCAAGCC 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1049471627 8:142777421-142777443 CCCGCCCCTGCCCCGCCTCCTGG No data
1049471620_1049471622 -9 Left 1049471620 8:142777383-142777405 CCTCCTGGGCTACTCACCAAGCC 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1049471622 8:142777397-142777419 CACCAAGCCGCGCTCACTGCAGG No data
1049471620_1049471629 16 Left 1049471620 8:142777383-142777405 CCTCCTGGGCTACTCACCAAGCC 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1049471629 8:142777422-142777444 CCGCCCCTGCCCCGCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049471620 Original CRISPR GGCTTGGTGAGTAGCCCAGG AGG (reversed) Intronic
901308157 1:8248619-8248641 GTCTTGCTGTGTCGCCCAGGCGG + Intergenic
903179803 1:21599477-21599499 GGCCTGGTGAGAGGCTCAGGGGG - Exonic
906368481 1:45231712-45231734 GTCTTGGTCTGTCGCCCAGGCGG - Intronic
906537728 1:46560946-46560968 GGTATTGTGAGTAGCCAAGGAGG + Intronic
907307321 1:53520591-53520613 GGCCAGGGGCGTAGCCCAGGAGG - Intronic
907409222 1:54273048-54273070 GACGTGGTGTGTAGCCCAGCTGG + Intronic
908820906 1:68085629-68085651 TGCATGGTGAGTGGCCCTGGGGG + Intergenic
909605405 1:77502851-77502873 GCTTTGGTGAGTAGTCCAAGAGG - Intronic
912843089 1:113056507-113056529 GTCTTGCTGTGTTGCCCAGGTGG - Intergenic
914854726 1:151342811-151342833 GGCTGAGTGAGTCCCCCAGGTGG + Exonic
915321435 1:155058436-155058458 GGCCTGGTGAGCAGCCTGGGTGG + Exonic
915916413 1:159943458-159943480 GGCTGGGTGAGCAGGCCAGCTGG - Exonic
916311160 1:163400231-163400253 GGCTTTGTGAGAAGCCCACCAGG - Intergenic
921213483 1:212918869-212918891 GGCTTGGGAAGAAGCCCAGCTGG + Intergenic
923492378 1:234495358-234495380 GGCTTCTTGAGTTGCCCAGTGGG - Intergenic
924410763 1:243802952-243802974 GTCTTGCTGTGTTGCCCAGGTGG - Intronic
924707743 1:246512613-246512635 GGTTTTTAGAGTAGCCCAGGGGG - Intergenic
1062804317 10:405817-405839 GGCTGTGTGAGGAGCCCTGGAGG - Intronic
1063737594 10:8778150-8778172 GGCTTGTTGATTATCACAGGGGG + Intergenic
1064353654 10:14599296-14599318 GGCCTGCTGAGCAGCCCAGAGGG + Intronic
1065659588 10:27992053-27992075 GGTTTGGGGAGTAGACCAAGGGG + Intronic
1066669175 10:37818655-37818677 GTCTTTGTGAGTAGCCCTGCTGG - Intronic
1067142645 10:43669632-43669654 GGCTTGGTGAGCAGCCCAGAGGG + Intergenic
1070045759 10:72834689-72834711 GCCTTGGTCTGTCGCCCAGGTGG + Intronic
1072439417 10:95440452-95440474 GGCATGCTCAGTAGCCTAGGTGG + Intronic
1072665403 10:97389122-97389144 GTCTTGCTCTGTAGCCCAGGCGG + Intronic
1073516896 10:104084336-104084358 GTCTTGCTGTGTTGCCCAGGTGG + Intronic
1074087381 10:110218685-110218707 GGTTGGGTGAGTTCCCCAGGGGG - Intronic
1078829684 11:14967774-14967796 GGCTTGCTGAGCAGATCAGGGGG - Intronic
1078841271 11:15077344-15077366 GGCTTGCTGAGCAGATCAGGGGG + Exonic
1079738596 11:24029443-24029465 AGCTTGATGAGTAGACCAGAGGG + Intergenic
1083159875 11:60848330-60848352 GCCTTGGGGAGAAGCCCGGGAGG + Intronic
1084185075 11:67467295-67467317 GGCTGGGTGAGTGGCCCTGAGGG - Exonic
1084649659 11:70481762-70481784 GTGGTGGTGAGTCGCCCAGGCGG + Intronic
1085414735 11:76312494-76312516 GGCTGGGTGTAAAGCCCAGGGGG + Intergenic
1085873851 11:80383213-80383235 GCCTTGCTCTGTAGCCCAGGTGG + Intergenic
1086093373 11:83026160-83026182 GTCTTGCTGTGTAGCCTAGGTGG - Intronic
1086318827 11:85623027-85623049 GTCTTGCTCTGTAGCCCAGGTGG - Intronic
1089462338 11:118660522-118660544 GGCTGGGTGAGCACCCCAGTAGG - Exonic
1090830915 11:130420340-130420362 GGCTTGGAGAGAAGGCCAGATGG + Intronic
1091136738 11:133197963-133197985 GGTTTTGTGAGTAGGCCTGGCGG - Intronic
1091216407 11:133904989-133905011 GGCTGGGTTAGAAGCCCCGGTGG + Intergenic
1091917344 12:4279272-4279294 GGCTTGGAGATAAGCCCAAGAGG + Intronic
1092194787 12:6542655-6542677 GGCTGGGTGAGAAGCCCTAGTGG + Intronic
1092964322 12:13626927-13626949 GGGTCAGTGAGTAGACCAGGAGG - Intronic
1095289863 12:40465535-40465557 GGCCTGGTGAGTTTCCCAGGTGG - Exonic
1095764684 12:45881605-45881627 GGCTTGGGGTGTGGCCTAGGAGG + Intronic
1096912450 12:54998009-54998031 GGCTTTGTGAGTTACCCTGGAGG - Intergenic
1097691915 12:62741603-62741625 GGCATGGAGGGTAGGCCAGGAGG - Intronic
1101463873 12:104926889-104926911 GTCTTGCTGTGTTGCCCAGGCGG - Intronic
1102483760 12:113242351-113242373 GGCTGGGGGTGTAGGCCAGGCGG - Intronic
1103478972 12:121238746-121238768 GGCCTGGTGGCTGGCCCAGGGGG - Exonic
1108278788 13:48840090-48840112 TGCTTGGTCAGAAGCACAGGTGG + Intergenic
1113548057 13:111169809-111169831 GGCTTGGTGAGTAAGGGAGGAGG + Intronic
1113664859 13:112134454-112134476 GGCCTGTGGAGGAGCCCAGGAGG + Intergenic
1116012620 14:39368429-39368451 GGCTTGGAGAATCTCCCAGGAGG + Intronic
1117170860 14:53094146-53094168 GTCTTGCTCTGTAGCCCAGGCGG - Intronic
1119174367 14:72558366-72558388 GGCTCAGAGAGTAGCCCTGGGGG - Intronic
1119607964 14:76037020-76037042 GTCTTGCTGTGTTGCCCAGGTGG + Intronic
1119644744 14:76340095-76340117 GGCAGGGTGGGGAGCCCAGGAGG + Intronic
1120704505 14:87733318-87733340 GTCTTGCTCTGTAGCCCAGGCGG - Intergenic
1121074283 14:91054605-91054627 GTCTTGCTGTGTTGCCCAGGTGG - Intronic
1202903726 14_GL000194v1_random:56949-56971 TCCTTGGTGAGGATCCCAGGAGG + Intergenic
1124445458 15:29727313-29727335 GTCTTGCTGTGTTGCCCAGGTGG - Intronic
1125259190 15:37802611-37802633 GTCTTGCTCAGTTGCCCAGGCGG + Intergenic
1126002517 15:44224448-44224470 GTCTTGCTCTGTAGCCCAGGTGG + Intergenic
1128070865 15:64796034-64796056 GTCTTGCTTTGTAGCCCAGGTGG + Intergenic
1128678064 15:69626313-69626335 GGTTGGGTGAGGAGCCCTGGAGG - Intergenic
1131069941 15:89459836-89459858 CCCTTTCTGAGTAGCCCAGGAGG + Intergenic
1133014458 16:2933075-2933097 GGGGTGGAGAGGAGCCCAGGAGG - Intronic
1133655877 16:7863185-7863207 GACTTTGGGAGTACCCCAGGGGG - Intergenic
1134081245 16:11326527-11326549 GTCTTGCTGTGTTGCCCAGGTGG + Intronic
1137499364 16:48998436-48998458 GGCCTGATGAGCAGCCCAGTGGG + Intergenic
1138179797 16:54933394-54933416 GGCTTGGCGAGCACCGCAGGAGG - Exonic
1139475996 16:67202840-67202862 GACCTGGGGAGTAGCCCAGGGGG - Intronic
1141451612 16:84107311-84107333 GGCTTGGTGACTAGAGCAGGTGG - Intronic
1142151666 16:88515235-88515257 GGCTGTGTGAATGGCCCAGGAGG - Intronic
1142227563 16:88885029-88885051 CGCTTGGTGAGCAGCCCGGTGGG - Exonic
1142655701 17:1392093-1392115 GGCATGCTGAGGTGCCCAGGGGG + Intronic
1143649667 17:8255686-8255708 AGCTTGGTGAGTAGCTGGGGAGG + Exonic
1144659455 17:17058626-17058648 GCCTTGGTGAGGAGGCCAGGAGG - Intronic
1144801743 17:17933549-17933571 AGCTTGGTGAAAAGCCCATGAGG - Intronic
1145218438 17:21069490-21069512 GGCTTGGTCAGGAACACAGGTGG + Intergenic
1145718782 17:27049228-27049250 GAATTGGTGAGTAGCCAAGGGGG + Intergenic
1146567281 17:33924251-33924273 GGGTTGGGGAGAACCCCAGGAGG - Intronic
1147551302 17:41444123-41444145 CACTTGGAGAGTAGCTCAGGAGG + Intergenic
1147671166 17:42177699-42177721 GGCTTGGTCAGGATCCTAGGAGG + Intronic
1148617646 17:49013299-49013321 GCCTTGGGGACTAGCCCGGGAGG + Intronic
1157704108 18:49787612-49787634 GTCTTGCTGTGTTGCCCAGGAGG - Intronic
1158521699 18:58176527-58176549 GTCTTGCTGTGTTGCCCAGGTGG + Intronic
1160625091 18:80198615-80198637 AGCCTGGTGAGTGCCCCAGGTGG - Intronic
1162531565 19:11239186-11239208 GGCCTGGTTAGTATCCAAGGGGG - Intronic
1163153257 19:15427174-15427196 CAGTTGGTGAGTGGCCCAGGGGG + Exonic
1163443564 19:17333879-17333901 GGAGTGGTGAGGAGCCCTGGCGG - Intronic
1164252308 19:23489534-23489556 GTCTTGCTGTATAGCCCAGGCGG - Intergenic
1164477215 19:28585051-28585073 GGCATGGTCAGGAGCCCACGTGG - Intergenic
1165962842 19:39549741-39549763 GTCTGGCTGTGTAGCCCAGGTGG - Intergenic
1166381034 19:42355524-42355546 GGCTTGGATAGCAGCTCAGGAGG + Intronic
1166785223 19:45363437-45363459 GGCTGGGGGAGGAGCCAAGGAGG - Intronic
1168044794 19:53786862-53786884 GGCTTGGGGCGGAGACCAGGGGG + Intergenic
925034541 2:675741-675763 TACTTGGTGAGTAGCCCAGGAGG - Intronic
926222647 2:10946421-10946443 GGCATGGTGGGCACCCCAGGGGG - Intergenic
926739232 2:16097328-16097350 AGCTTGCTGGGCAGCCCAGGTGG + Intergenic
927802802 2:26116891-26116913 GTCTTGCTGTGTTGCCCAGGAGG + Intronic
930183881 2:48391765-48391787 GTTATGCTGAGTAGCCCAGGGGG - Intergenic
930364979 2:50428216-50428238 GTCTTGCTGTGTTGCCCAGGTGG - Intronic
931548464 2:63415165-63415187 GTCTTGCTAAGTTGCCCAGGTGG - Intronic
933632052 2:84670071-84670093 GGCTTGAAGAGTAGCCAAGATGG + Intronic
933702607 2:85266501-85266523 GGCTTGATGCCCAGCCCAGGAGG + Intronic
933921129 2:87047552-87047574 GGCTTGGTTTATAGGCCAGGTGG - Intergenic
933930506 2:87146243-87146265 GGCTTGGTTTATAGGCCAGGTGG + Intergenic
934001837 2:87722033-87722055 GGCTTGGTTTATAGGCCAGGTGG + Intergenic
935335379 2:102010635-102010657 GGCTTGGAAAGTTCCCCAGGTGG + Intronic
942532269 2:176923782-176923804 GGCTTGGGCAGGAGCCAAGGGGG - Intergenic
943830846 2:192459700-192459722 GTCTTGCTGTGTTGCCCAGGTGG + Intergenic
945030808 2:205662147-205662169 AGCTTGGTGAGTTTCCCAGTAGG + Intergenic
946085924 2:217171450-217171472 GGAGTGGGGAGGAGCCCAGGTGG - Intergenic
946292785 2:218757980-218758002 GGCTTGGTCAGAATCTCAGGTGG - Intergenic
947416716 2:229904005-229904027 GTCTTGCTCAGTTGCCCAGGCGG - Intronic
948514256 2:238493653-238493675 GTCTTGCTGTGTTGCCCAGGGGG + Intergenic
1169303936 20:4471849-4471871 GGATTGGGGAGCAGCCCAGCAGG - Intergenic
1170368038 20:15618609-15618631 GTCTTGGTGCTTAGCCCAAGGGG + Intronic
1170790819 20:19508099-19508121 GGCTTTGTGAGAAGCGGAGGAGG + Intronic
1171896063 20:30811993-30812015 GGTTTTCTGACTAGCCCAGGCGG + Intergenic
1172333721 20:34096256-34096278 GTCTTGCTGTGTTGCCCAGGAGG - Intronic
1172468043 20:35171804-35171826 GGCTTGGTGAGAAGTCCTGCCGG - Intergenic
1172742118 20:37177182-37177204 GTCTTGCTGTGTTGCCCAGGTGG + Intronic
1173968253 20:47130291-47130313 GTCTTGCTCTGTAGCCCAGGTGG + Intronic
1174707422 20:52670625-52670647 GGATTGGAGATTAGCCCATGAGG - Intergenic
1176623091 21:9071717-9071739 TCCTTGGTGAGGATCCCAGGAGG + Intergenic
1178492458 21:33061452-33061474 GTCTTGCTGTGTTGCCCAGGTGG - Intergenic
1181113991 22:20619721-20619743 GGCTTGCTGTGTTGCCCTGGTGG - Intergenic
1182258034 22:29051943-29051965 GGCGGGTTGAGAAGCCCAGGAGG - Intronic
1184735967 22:46398033-46398055 GGCTGGGTGAGGAGCTCAGAGGG + Intronic
950013986 3:9743466-9743488 TTCCTGGTGAGAAGCCCAGGGGG + Intronic
950487097 3:13280404-13280426 GGTTTGCTGAGCAGCCCCGGGGG + Intergenic
950677649 3:14564359-14564381 GGCTTGAGGAGGAGCCCCGGTGG - Intergenic
955413349 3:58670191-58670213 GGGCTGGTGAGTAGAGCAGGGGG - Intergenic
956938935 3:74135149-74135171 GGCTTGGCTAGTAGGCCAGGAGG + Intergenic
957892899 3:86382632-86382654 GTATGGGTGACTAGCCCAGGTGG + Intergenic
961378112 3:126480448-126480470 GGCTTGGTATGGAGCCCAGAGGG + Intergenic
961405131 3:126672959-126672981 GGCCTGGCGAGCAGCCAAGGAGG - Intergenic
961694614 3:128695786-128695808 GTCTTGCTGTGTTGCCCAGGCGG - Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967723241 3:192837422-192837444 TGCTTGGTGGGAAGCCCAGGTGG - Intronic
967921067 3:194614948-194614970 GCCGTGGTGCGTAGCCCAGTTGG - Intronic
968465773 4:749905-749927 GGCTTGGGCAGGAGCCCAGGAGG - Intronic
968519982 4:1030829-1030851 GCCTTGGGCAGGAGCCCAGGTGG + Intergenic
968658435 4:1788539-1788561 GGCTGGGGCAGGAGCCCAGGGGG + Intergenic
968863515 4:3192270-3192292 GTCTTGCTGTGTTGCCCAGGCGG + Intronic
968962672 4:3753312-3753334 GGCGTCCTGAGGAGCCCAGGGGG + Intergenic
975481850 4:74889640-74889662 GGCTTGGTGAGGTGCACAGGAGG + Intergenic
980966984 4:139531466-139531488 GGCCTCGTGAGTAGCCAGGGTGG - Intronic
982222610 4:153137871-153137893 GTCTTGCTGTGTTGCCCAGGCGG - Intergenic
983269221 4:165541865-165541887 GCCATGTTGAGAAGCCCAGGTGG - Intergenic
985643826 5:1075821-1075843 GGCTTGGGGCGTAGCCCATCAGG - Intronic
989293983 5:39802467-39802489 TGCTTGGTAAGTAGTCTAGGAGG - Intergenic
997564353 5:134875524-134875546 GGCTTGCTCTGTTGCCCAGGCGG + Intronic
998634669 5:143940276-143940298 GGCTTGGTGATGAACACAGGTGG - Intergenic
999517623 5:152316889-152316911 GGCTTGCTGTGTTGCCCAGGTGG + Intergenic
1000446842 5:161332135-161332157 GTCTTGCTGTGTGGCCCAGGCGG - Intronic
1001379519 5:171294446-171294468 GGCTTGGGAGGTAGCCCAGGTGG - Intronic
1001813620 5:174649366-174649388 GCCTAGGTGAAGAGCCCAGGAGG - Intergenic
1002641025 5:180630756-180630778 GGCTTGGCCAGGAGCTCAGGAGG - Exonic
1002932234 6:1642726-1642748 GTCTTTGTGAATAGCACAGGTGG + Intronic
1004361496 6:14975235-14975257 GGCTTTGTGAGTATCCCAGCAGG + Intergenic
1007876833 6:45112733-45112755 TGCTTGGTGACTGGCCCAGCAGG - Intronic
1012868571 6:104646319-104646341 TGTTTGGTGTGTTGCCCAGGTGG - Intergenic
1018877600 6:167838754-167838776 AGCTTGGCGAGTAACCCTGGAGG + Intronic
1019268361 7:131773-131795 GGCTTGGTGAGCTGCCCACATGG - Intergenic
1019447956 7:1081208-1081230 GGCTTGGTGCCTAGGCCGGGTGG + Intronic
1019487431 7:1295868-1295890 GGCTGGGTGGGTGGCCCAGGGGG - Intergenic
1026671309 7:72392967-72392989 GTCTTGCTGTGTTGCCCAGGTGG - Intronic
1032128027 7:129208846-129208868 GCCTGGGTGAGTGGCCCCGGGGG + Exonic
1034460288 7:151194239-151194261 GGCTTGGTGAGAGGCTCTGGGGG - Exonic
1034946229 7:155263548-155263570 AGCTTGGTGAACAGACCAGGAGG + Intergenic
1034978832 7:155463147-155463169 GGCTTGGTGAGGACAGCAGGAGG + Exonic
1035351788 7:158252461-158252483 GGGTTGGTGAGCACTCCAGGCGG + Intronic
1035999102 8:4582116-4582138 AGCTTTGTGAGTAGCACATGAGG + Intronic
1036751177 8:11444466-11444488 GGCTTGGTGGGTGGCACAGTTGG + Exonic
1040069156 8:43175592-43175614 GTCTTGCTCTGTAGCCCAGGTGG + Intronic
1041502403 8:58553298-58553320 GGCTAGGTGAGAGGCCAAGGGGG + Exonic
1042384100 8:68152644-68152666 ACCATGGTGAGTAGCTCAGGAGG + Intronic
1045279313 8:100735944-100735966 GTCTTGCTGTGTTGCCCAGGTGG - Intergenic
1045473309 8:102532178-102532200 GCCTTGGTCAGAAGCACAGGAGG - Intronic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1049471620 8:142777383-142777405 GGCTTGGTGAGTAGCCCAGGAGG - Intronic
1049660705 8:143818604-143818626 GGCTGGGTGGGTGGGCCAGGAGG - Intronic
1049779652 8:144423071-144423093 GGCTTGGGGAGAGGCCCTGGTGG + Intergenic
1053069374 9:35092079-35092101 GGCATTGTGAGTAGCTTAGGTGG + Exonic
1054958856 9:70944552-70944574 GGCTTGTTGAGTAGGAGAGGAGG - Intronic
1055476465 9:76667946-76667968 GGCTTGGTGGGTAGCGTAGGGGG + Intronic
1056733015 9:89181987-89182009 GGGTTGGTGAGGAGGTCAGGAGG + Intergenic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1057962626 9:99471107-99471129 TGCATTGTGAGTTGCCCAGGCGG - Intergenic
1059441072 9:114307215-114307237 GGCTTCCTGAGAAGCCCAGTGGG + Intronic
1060228078 9:121808340-121808362 GGGGAGGTGAGTCGCCCAGGTGG - Intergenic
1061411845 9:130426061-130426083 GGCCAGGTGAGTAGGCCAGCCGG - Intronic
1062398570 9:136362619-136362641 GGCTTGGGGTGTGGACCAGGAGG - Intronic
1203746280 Un_GL000218v1:42144-42166 TCCTTGGTGAGGATCCCAGGAGG + Intergenic
1186717613 X:12269215-12269237 AGTTTGGGGAGAAGCCCAGGAGG + Intronic
1197707030 X:129641387-129641409 AGCTTGGGCAGCAGCCCAGGAGG - Intergenic
1201159608 Y:11157158-11157180 CCCTTGGTGAGGATCCCAGGAGG + Intergenic