ID: 1049471752

View in Genome Browser
Species Human (GRCh38)
Location 8:142777829-142777851
Sequence CGGCGCGGGCGAGTGGGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 2, 1: 0, 2: 1, 3: 51, 4: 518}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049471752_1049471756 -10 Left 1049471752 8:142777829-142777851 CCTCCGCCCACTCGCCCGCGCCG 0: 2
1: 0
2: 1
3: 51
4: 518
Right 1049471756 8:142777842-142777864 GCCCGCGCCGCGTCGTTTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 11
1049471752_1049471761 8 Left 1049471752 8:142777829-142777851 CCTCCGCCCACTCGCCCGCGCCG 0: 2
1: 0
2: 1
3: 51
4: 518
Right 1049471761 8:142777860-142777882 GTCGGCCGGCACCAGCCTTGCGG 0: 1
1: 0
2: 1
3: 3
4: 86
1049471752_1049471759 -6 Left 1049471752 8:142777829-142777851 CCTCCGCCCACTCGCCCGCGCCG 0: 2
1: 0
2: 1
3: 51
4: 518
Right 1049471759 8:142777846-142777868 GCGCCGCGTCGTTTGTCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049471752 Original CRISPR CGGCGCGGGCGAGTGGGCGG AGG (reversed) Exonic