ID: 1049472415

View in Genome Browser
Species Human (GRCh38)
Location 8:142782422-142782444
Sequence TAGTTTCCCCATACGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049472408_1049472415 -9 Left 1049472408 8:142782408-142782430 CCCTTGCCCAGCCTTAGTTTCCC No data
Right 1049472415 8:142782422-142782444 TAGTTTCCCCATACGGAAGTGGG No data
1049472406_1049472415 19 Left 1049472406 8:142782380-142782402 CCTGCCGTGAAGTGGCAGGAGTC No data
Right 1049472415 8:142782422-142782444 TAGTTTCCCCATACGGAAGTGGG No data
1049472407_1049472415 15 Left 1049472407 8:142782384-142782406 CCGTGAAGTGGCAGGAGTCACTT No data
Right 1049472415 8:142782422-142782444 TAGTTTCCCCATACGGAAGTGGG No data
1049472402_1049472415 30 Left 1049472402 8:142782369-142782391 CCTGCAGCCAGCCTGCCGTGAAG No data
Right 1049472415 8:142782422-142782444 TAGTTTCCCCATACGGAAGTGGG No data
1049472409_1049472415 -10 Left 1049472409 8:142782409-142782431 CCTTGCCCAGCCTTAGTTTCCCC No data
Right 1049472415 8:142782422-142782444 TAGTTTCCCCATACGGAAGTGGG No data
1049472404_1049472415 23 Left 1049472404 8:142782376-142782398 CCAGCCTGCCGTGAAGTGGCAGG No data
Right 1049472415 8:142782422-142782444 TAGTTTCCCCATACGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049472415 Original CRISPR TAGTTTCCCCATACGGAAGT GGG Intergenic
No off target data available for this crispr