ID: 1049473891

View in Genome Browser
Species Human (GRCh38)
Location 8:142788104-142788126
Sequence CAGGCCCCGGCACTGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049473891_1049473907 28 Left 1049473891 8:142788104-142788126 CCCTGACACAGTGCCGGGGCCTG No data
Right 1049473907 8:142788155-142788177 GGTGGTGCCTTTAGAAACCAGGG No data
1049473891_1049473896 -6 Left 1049473891 8:142788104-142788126 CCCTGACACAGTGCCGGGGCCTG No data
Right 1049473896 8:142788121-142788143 GGCCTGGAGGATCCACCTACAGG No data
1049473891_1049473898 -3 Left 1049473891 8:142788104-142788126 CCCTGACACAGTGCCGGGGCCTG No data
Right 1049473898 8:142788124-142788146 CTGGAGGATCCACCTACAGGAGG No data
1049473891_1049473904 10 Left 1049473891 8:142788104-142788126 CCCTGACACAGTGCCGGGGCCTG No data
Right 1049473904 8:142788137-142788159 CTACAGGAGGGGTTGCCTGGTGG No data
1049473891_1049473906 27 Left 1049473891 8:142788104-142788126 CCCTGACACAGTGCCGGGGCCTG No data
Right 1049473906 8:142788154-142788176 TGGTGGTGCCTTTAGAAACCAGG No data
1049473891_1049473899 -2 Left 1049473891 8:142788104-142788126 CCCTGACACAGTGCCGGGGCCTG No data
Right 1049473899 8:142788125-142788147 TGGAGGATCCACCTACAGGAGGG No data
1049473891_1049473902 7 Left 1049473891 8:142788104-142788126 CCCTGACACAGTGCCGGGGCCTG No data
Right 1049473902 8:142788134-142788156 CACCTACAGGAGGGGTTGCCTGG No data
1049473891_1049473900 -1 Left 1049473891 8:142788104-142788126 CCCTGACACAGTGCCGGGGCCTG No data
Right 1049473900 8:142788126-142788148 GGAGGATCCACCTACAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049473891 Original CRISPR CAGGCCCCGGCACTGTGTCA GGG (reversed) Intergenic
No off target data available for this crispr