ID: 1049473924

View in Genome Browser
Species Human (GRCh38)
Location 8:142788205-142788227
Sequence CCACATTTGCATCTGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049473912_1049473924 10 Left 1049473912 8:142788172-142788194 CCAGGGTGCAGGCGGGAGCCCCC No data
Right 1049473924 8:142788205-142788227 CCACATTTGCATCTGGTGCCTGG No data
1049473916_1049473924 -8 Left 1049473916 8:142788190-142788212 CCCCCTGGGGCAGCCCCACATTT No data
Right 1049473924 8:142788205-142788227 CCACATTTGCATCTGGTGCCTGG No data
1049473917_1049473924 -9 Left 1049473917 8:142788191-142788213 CCCCTGGGGCAGCCCCACATTTG No data
Right 1049473924 8:142788205-142788227 CCACATTTGCATCTGGTGCCTGG No data
1049473918_1049473924 -10 Left 1049473918 8:142788192-142788214 CCCTGGGGCAGCCCCACATTTGC No data
Right 1049473924 8:142788205-142788227 CCACATTTGCATCTGGTGCCTGG No data
1049473905_1049473924 30 Left 1049473905 8:142788152-142788174 CCTGGTGGTGCCTTTAGAAACCA No data
Right 1049473924 8:142788205-142788227 CCACATTTGCATCTGGTGCCTGG No data
1049473909_1049473924 20 Left 1049473909 8:142788162-142788184 CCTTTAGAAACCAGGGTGCAGGC No data
Right 1049473924 8:142788205-142788227 CCACATTTGCATCTGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049473924 Original CRISPR CCACATTTGCATCTGGTGCC TGG Intergenic
No off target data available for this crispr