ID: 1049474406

View in Genome Browser
Species Human (GRCh38)
Location 8:142790119-142790141
Sequence CTGCTTAGACAGCTCCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049474406_1049474412 2 Left 1049474406 8:142790119-142790141 CCTTGTTGGAGCTGTCTAAGCAG No data
Right 1049474412 8:142790144-142790166 AAGGGTGTGTGGCCATTACCTGG No data
1049474406_1049474419 21 Left 1049474406 8:142790119-142790141 CCTTGTTGGAGCTGTCTAAGCAG No data
Right 1049474419 8:142790163-142790185 CTGGTAAGCAGGTGGGTGTCGGG No data
1049474406_1049474420 26 Left 1049474406 8:142790119-142790141 CCTTGTTGGAGCTGTCTAAGCAG No data
Right 1049474420 8:142790168-142790190 AAGCAGGTGGGTGTCGGGCAAGG No data
1049474406_1049474421 27 Left 1049474406 8:142790119-142790141 CCTTGTTGGAGCTGTCTAAGCAG No data
Right 1049474421 8:142790169-142790191 AGCAGGTGGGTGTCGGGCAAGGG No data
1049474406_1049474413 10 Left 1049474406 8:142790119-142790141 CCTTGTTGGAGCTGTCTAAGCAG No data
Right 1049474413 8:142790152-142790174 GTGGCCATTACCTGGTAAGCAGG No data
1049474406_1049474416 14 Left 1049474406 8:142790119-142790141 CCTTGTTGGAGCTGTCTAAGCAG No data
Right 1049474416 8:142790156-142790178 CCATTACCTGGTAAGCAGGTGGG No data
1049474406_1049474411 -9 Left 1049474406 8:142790119-142790141 CCTTGTTGGAGCTGTCTAAGCAG No data
Right 1049474411 8:142790133-142790155 TCTAAGCAGGGAAGGGTGTGTGG No data
1049474406_1049474418 20 Left 1049474406 8:142790119-142790141 CCTTGTTGGAGCTGTCTAAGCAG No data
Right 1049474418 8:142790162-142790184 CCTGGTAAGCAGGTGGGTGTCGG No data
1049474406_1049474414 13 Left 1049474406 8:142790119-142790141 CCTTGTTGGAGCTGTCTAAGCAG No data
Right 1049474414 8:142790155-142790177 GCCATTACCTGGTAAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049474406 Original CRISPR CTGCTTAGACAGCTCCAACA AGG (reversed) Intergenic
No off target data available for this crispr