ID: 1049474590

View in Genome Browser
Species Human (GRCh38)
Location 8:142790814-142790836
Sequence GGAACAGGTTTGTTTCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049474590_1049474601 6 Left 1049474590 8:142790814-142790836 CCCAAGAGAAACAAACCTGTTCC No data
Right 1049474601 8:142790843-142790865 TGGCTGGTGGTGCCCACAGGCGG No data
1049474590_1049474609 30 Left 1049474590 8:142790814-142790836 CCCAAGAGAAACAAACCTGTTCC No data
Right 1049474609 8:142790867-142790889 GCTGGCACCTTCCCTGGGAGAGG No data
1049474590_1049474603 8 Left 1049474590 8:142790814-142790836 CCCAAGAGAAACAAACCTGTTCC No data
Right 1049474603 8:142790845-142790867 GCTGGTGGTGCCCACAGGCGGGG No data
1049474590_1049474602 7 Left 1049474590 8:142790814-142790836 CCCAAGAGAAACAAACCTGTTCC No data
Right 1049474602 8:142790844-142790866 GGCTGGTGGTGCCCACAGGCGGG No data
1049474590_1049474594 -10 Left 1049474590 8:142790814-142790836 CCCAAGAGAAACAAACCTGTTCC No data
Right 1049474594 8:142790827-142790849 AACCTGTTCCCAGGCCTGGCTGG No data
1049474590_1049474607 24 Left 1049474590 8:142790814-142790836 CCCAAGAGAAACAAACCTGTTCC No data
Right 1049474607 8:142790861-142790883 GGCGGGGCTGGCACCTTCCCTGG No data
1049474590_1049474599 3 Left 1049474590 8:142790814-142790836 CCCAAGAGAAACAAACCTGTTCC No data
Right 1049474599 8:142790840-142790862 GCCTGGCTGGTGGTGCCCACAGG No data
1049474590_1049474608 25 Left 1049474590 8:142790814-142790836 CCCAAGAGAAACAAACCTGTTCC No data
Right 1049474608 8:142790862-142790884 GCGGGGCTGGCACCTTCCCTGGG No data
1049474590_1049474604 12 Left 1049474590 8:142790814-142790836 CCCAAGAGAAACAAACCTGTTCC No data
Right 1049474604 8:142790849-142790871 GTGGTGCCCACAGGCGGGGCTGG No data
1049474590_1049474596 -7 Left 1049474590 8:142790814-142790836 CCCAAGAGAAACAAACCTGTTCC No data
Right 1049474596 8:142790830-142790852 CTGTTCCCAGGCCTGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049474590 Original CRISPR GGAACAGGTTTGTTTCTCTT GGG (reversed) Intergenic
No off target data available for this crispr