ID: 1049474591

View in Genome Browser
Species Human (GRCh38)
Location 8:142790815-142790837
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049474591_1049474596 -8 Left 1049474591 8:142790815-142790837 CCAAGAGAAACAAACCTGTTCCC No data
Right 1049474596 8:142790830-142790852 CTGTTCCCAGGCCTGGCTGGTGG No data
1049474591_1049474604 11 Left 1049474591 8:142790815-142790837 CCAAGAGAAACAAACCTGTTCCC No data
Right 1049474604 8:142790849-142790871 GTGGTGCCCACAGGCGGGGCTGG No data
1049474591_1049474601 5 Left 1049474591 8:142790815-142790837 CCAAGAGAAACAAACCTGTTCCC No data
Right 1049474601 8:142790843-142790865 TGGCTGGTGGTGCCCACAGGCGG No data
1049474591_1049474603 7 Left 1049474591 8:142790815-142790837 CCAAGAGAAACAAACCTGTTCCC No data
Right 1049474603 8:142790845-142790867 GCTGGTGGTGCCCACAGGCGGGG No data
1049474591_1049474607 23 Left 1049474591 8:142790815-142790837 CCAAGAGAAACAAACCTGTTCCC No data
Right 1049474607 8:142790861-142790883 GGCGGGGCTGGCACCTTCCCTGG No data
1049474591_1049474609 29 Left 1049474591 8:142790815-142790837 CCAAGAGAAACAAACCTGTTCCC No data
Right 1049474609 8:142790867-142790889 GCTGGCACCTTCCCTGGGAGAGG No data
1049474591_1049474599 2 Left 1049474591 8:142790815-142790837 CCAAGAGAAACAAACCTGTTCCC No data
Right 1049474599 8:142790840-142790862 GCCTGGCTGGTGGTGCCCACAGG No data
1049474591_1049474608 24 Left 1049474591 8:142790815-142790837 CCAAGAGAAACAAACCTGTTCCC No data
Right 1049474608 8:142790862-142790884 GCGGGGCTGGCACCTTCCCTGGG No data
1049474591_1049474602 6 Left 1049474591 8:142790815-142790837 CCAAGAGAAACAAACCTGTTCCC No data
Right 1049474602 8:142790844-142790866 GGCTGGTGGTGCCCACAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049474591 Original CRISPR GGGAACAGGTTTGTTTCTCT TGG (reversed) Intergenic
No off target data available for this crispr