ID: 1049474600

View in Genome Browser
Species Human (GRCh38)
Location 8:142790841-142790863
Sequence GCCTGTGGGCACCACCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049474600_1049474614 27 Left 1049474600 8:142790841-142790863 CCTGGCTGGTGGTGCCCACAGGC No data
Right 1049474614 8:142790891-142790913 ACCATTTCAGCACCTAGGACCGG No data
1049474600_1049474607 -3 Left 1049474600 8:142790841-142790863 CCTGGCTGGTGGTGCCCACAGGC No data
Right 1049474607 8:142790861-142790883 GGCGGGGCTGGCACCTTCCCTGG No data
1049474600_1049474608 -2 Left 1049474600 8:142790841-142790863 CCTGGCTGGTGGTGCCCACAGGC No data
Right 1049474608 8:142790862-142790884 GCGGGGCTGGCACCTTCCCTGGG No data
1049474600_1049474609 3 Left 1049474600 8:142790841-142790863 CCTGGCTGGTGGTGCCCACAGGC No data
Right 1049474609 8:142790867-142790889 GCTGGCACCTTCCCTGGGAGAGG No data
1049474600_1049474613 22 Left 1049474600 8:142790841-142790863 CCTGGCTGGTGGTGCCCACAGGC No data
Right 1049474613 8:142790886-142790908 GAGGCACCATTTCAGCACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049474600 Original CRISPR GCCTGTGGGCACCACCAGCC AGG (reversed) Intergenic
No off target data available for this crispr