ID: 1049474607

View in Genome Browser
Species Human (GRCh38)
Location 8:142790861-142790883
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049474590_1049474607 24 Left 1049474590 8:142790814-142790836 CCCAAGAGAAACAAACCTGTTCC No data
Right 1049474607 8:142790861-142790883 GGCGGGGCTGGCACCTTCCCTGG No data
1049474598_1049474607 2 Left 1049474598 8:142790836-142790858 CCAGGCCTGGCTGGTGGTGCCCA No data
Right 1049474607 8:142790861-142790883 GGCGGGGCTGGCACCTTCCCTGG No data
1049474595_1049474607 9 Left 1049474595 8:142790829-142790851 CCTGTTCCCAGGCCTGGCTGGTG No data
Right 1049474607 8:142790861-142790883 GGCGGGGCTGGCACCTTCCCTGG No data
1049474597_1049474607 3 Left 1049474597 8:142790835-142790857 CCCAGGCCTGGCTGGTGGTGCCC No data
Right 1049474607 8:142790861-142790883 GGCGGGGCTGGCACCTTCCCTGG No data
1049474591_1049474607 23 Left 1049474591 8:142790815-142790837 CCAAGAGAAACAAACCTGTTCCC No data
Right 1049474607 8:142790861-142790883 GGCGGGGCTGGCACCTTCCCTGG No data
1049474600_1049474607 -3 Left 1049474600 8:142790841-142790863 CCTGGCTGGTGGTGCCCACAGGC No data
Right 1049474607 8:142790861-142790883 GGCGGGGCTGGCACCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049474607 Original CRISPR GGCGGGGCTGGCACCTTCCC TGG Intergenic
No off target data available for this crispr