ID: 1049474613

View in Genome Browser
Species Human (GRCh38)
Location 8:142790886-142790908
Sequence GAGGCACCATTTCAGCACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049474600_1049474613 22 Left 1049474600 8:142790841-142790863 CCTGGCTGGTGGTGCCCACAGGC No data
Right 1049474613 8:142790886-142790908 GAGGCACCATTTCAGCACCTAGG No data
1049474598_1049474613 27 Left 1049474598 8:142790836-142790858 CCAGGCCTGGCTGGTGGTGCCCA No data
Right 1049474613 8:142790886-142790908 GAGGCACCATTTCAGCACCTAGG No data
1049474606_1049474613 7 Left 1049474606 8:142790856-142790878 CCACAGGCGGGGCTGGCACCTTC No data
Right 1049474613 8:142790886-142790908 GAGGCACCATTTCAGCACCTAGG No data
1049474597_1049474613 28 Left 1049474597 8:142790835-142790857 CCCAGGCCTGGCTGGTGGTGCCC No data
Right 1049474613 8:142790886-142790908 GAGGCACCATTTCAGCACCTAGG No data
1049474605_1049474613 8 Left 1049474605 8:142790855-142790877 CCCACAGGCGGGGCTGGCACCTT No data
Right 1049474613 8:142790886-142790908 GAGGCACCATTTCAGCACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049474613 Original CRISPR GAGGCACCATTTCAGCACCT AGG Intergenic
No off target data available for this crispr