ID: 1049474614

View in Genome Browser
Species Human (GRCh38)
Location 8:142790891-142790913
Sequence ACCATTTCAGCACCTAGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049474605_1049474614 13 Left 1049474605 8:142790855-142790877 CCCACAGGCGGGGCTGGCACCTT No data
Right 1049474614 8:142790891-142790913 ACCATTTCAGCACCTAGGACCGG No data
1049474606_1049474614 12 Left 1049474606 8:142790856-142790878 CCACAGGCGGGGCTGGCACCTTC No data
Right 1049474614 8:142790891-142790913 ACCATTTCAGCACCTAGGACCGG No data
1049474611_1049474614 -10 Left 1049474611 8:142790878-142790900 CCCTGGGAGAGGCACCATTTCAG No data
Right 1049474614 8:142790891-142790913 ACCATTTCAGCACCTAGGACCGG No data
1049474610_1049474614 -6 Left 1049474610 8:142790874-142790896 CCTTCCCTGGGAGAGGCACCATT No data
Right 1049474614 8:142790891-142790913 ACCATTTCAGCACCTAGGACCGG No data
1049474600_1049474614 27 Left 1049474600 8:142790841-142790863 CCTGGCTGGTGGTGCCCACAGGC No data
Right 1049474614 8:142790891-142790913 ACCATTTCAGCACCTAGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049474614 Original CRISPR ACCATTTCAGCACCTAGGAC CGG Intergenic
No off target data available for this crispr