ID: 1049477467

View in Genome Browser
Species Human (GRCh38)
Location 8:142803458-142803480
Sequence CTCCCTACAGGACACTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049477467_1049477474 15 Left 1049477467 8:142803458-142803480 CCTGCAGAGTGTCCTGTAGGGAG No data
Right 1049477474 8:142803496-142803518 ATCCTGTACAGGTGTCCTATAGG No data
1049477467_1049477471 -10 Left 1049477467 8:142803458-142803480 CCTGCAGAGTGTCCTGTAGGGAG No data
Right 1049477471 8:142803471-142803493 CTGTAGGGAGTGTCCTGTAGGGG No data
1049477467_1049477475 16 Left 1049477467 8:142803458-142803480 CCTGCAGAGTGTCCTGTAGGGAG No data
Right 1049477475 8:142803497-142803519 TCCTGTACAGGTGTCCTATAGGG No data
1049477467_1049477477 29 Left 1049477467 8:142803458-142803480 CCTGCAGAGTGTCCTGTAGGGAG No data
Right 1049477477 8:142803510-142803532 TCCTATAGGGATCGTCCTGTAGG No data
1049477467_1049477473 4 Left 1049477467 8:142803458-142803480 CCTGCAGAGTGTCCTGTAGGGAG No data
Right 1049477473 8:142803485-142803507 CTGTAGGGGATATCCTGTACAGG No data
1049477467_1049477479 30 Left 1049477467 8:142803458-142803480 CCTGCAGAGTGTCCTGTAGGGAG No data
Right 1049477479 8:142803511-142803533 CCTATAGGGATCGTCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049477467 Original CRISPR CTCCCTACAGGACACTCTGC AGG (reversed) Intergenic