ID: 1049477469

View in Genome Browser
Species Human (GRCh38)
Location 8:142803470-142803492
Sequence CCCTACAGGACACTCCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049477469_1049477480 19 Left 1049477469 8:142803470-142803492 CCTGTAGGGAGTGTCCTGTAGGG No data
Right 1049477480 8:142803512-142803534 CTATAGGGATCGTCCTGTAGGGG No data
1049477469_1049477477 17 Left 1049477469 8:142803470-142803492 CCTGTAGGGAGTGTCCTGTAGGG No data
Right 1049477477 8:142803510-142803532 TCCTATAGGGATCGTCCTGTAGG No data
1049477469_1049477481 30 Left 1049477469 8:142803470-142803492 CCTGTAGGGAGTGTCCTGTAGGG No data
Right 1049477481 8:142803523-142803545 GTCCTGTAGGGGTGTCCTGTAGG No data
1049477469_1049477473 -8 Left 1049477469 8:142803470-142803492 CCTGTAGGGAGTGTCCTGTAGGG No data
Right 1049477473 8:142803485-142803507 CTGTAGGGGATATCCTGTACAGG No data
1049477469_1049477475 4 Left 1049477469 8:142803470-142803492 CCTGTAGGGAGTGTCCTGTAGGG No data
Right 1049477475 8:142803497-142803519 TCCTGTACAGGTGTCCTATAGGG No data
1049477469_1049477479 18 Left 1049477469 8:142803470-142803492 CCTGTAGGGAGTGTCCTGTAGGG No data
Right 1049477479 8:142803511-142803533 CCTATAGGGATCGTCCTGTAGGG No data
1049477469_1049477474 3 Left 1049477469 8:142803470-142803492 CCTGTAGGGAGTGTCCTGTAGGG No data
Right 1049477474 8:142803496-142803518 ATCCTGTACAGGTGTCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049477469 Original CRISPR CCCTACAGGACACTCCCTAC AGG (reversed) Intergenic