ID: 1049477472

View in Genome Browser
Species Human (GRCh38)
Location 8:142803484-142803506
Sequence CTGTACAGGATATCCCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049477472_1049477479 4 Left 1049477472 8:142803484-142803506 CCTGTAGGGGATATCCTGTACAG No data
Right 1049477479 8:142803511-142803533 CCTATAGGGATCGTCCTGTAGGG No data
1049477472_1049477480 5 Left 1049477472 8:142803484-142803506 CCTGTAGGGGATATCCTGTACAG No data
Right 1049477480 8:142803512-142803534 CTATAGGGATCGTCCTGTAGGGG No data
1049477472_1049477484 18 Left 1049477472 8:142803484-142803506 CCTGTAGGGGATATCCTGTACAG No data
Right 1049477484 8:142803525-142803547 CCTGTAGGGGTGTCCTGTAGGGG No data
1049477472_1049477485 19 Left 1049477472 8:142803484-142803506 CCTGTAGGGGATATCCTGTACAG No data
Right 1049477485 8:142803526-142803548 CTGTAGGGGTGTCCTGTAGGGGG No data
1049477472_1049477481 16 Left 1049477472 8:142803484-142803506 CCTGTAGGGGATATCCTGTACAG No data
Right 1049477481 8:142803523-142803545 GTCCTGTAGGGGTGTCCTGTAGG No data
1049477472_1049477475 -10 Left 1049477472 8:142803484-142803506 CCTGTAGGGGATATCCTGTACAG No data
Right 1049477475 8:142803497-142803519 TCCTGTACAGGTGTCCTATAGGG No data
1049477472_1049477477 3 Left 1049477472 8:142803484-142803506 CCTGTAGGGGATATCCTGTACAG No data
Right 1049477477 8:142803510-142803532 TCCTATAGGGATCGTCCTGTAGG No data
1049477472_1049477486 30 Left 1049477472 8:142803484-142803506 CCTGTAGGGGATATCCTGTACAG No data
Right 1049477486 8:142803537-142803559 TCCTGTAGGGGGTGCCCTGTAGG No data
1049477472_1049477482 17 Left 1049477472 8:142803484-142803506 CCTGTAGGGGATATCCTGTACAG No data
Right 1049477482 8:142803524-142803546 TCCTGTAGGGGTGTCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049477472 Original CRISPR CTGTACAGGATATCCCCTAC AGG (reversed) Intergenic