ID: 1049477476

View in Genome Browser
Species Human (GRCh38)
Location 8:142803498-142803520
Sequence TCCCTATAGGACACCTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049477476_1049477480 -9 Left 1049477476 8:142803498-142803520 CCTGTACAGGTGTCCTATAGGGA No data
Right 1049477480 8:142803512-142803534 CTATAGGGATCGTCCTGTAGGGG No data
1049477476_1049477485 5 Left 1049477476 8:142803498-142803520 CCTGTACAGGTGTCCTATAGGGA No data
Right 1049477485 8:142803526-142803548 CTGTAGGGGTGTCCTGTAGGGGG No data
1049477476_1049477486 16 Left 1049477476 8:142803498-142803520 CCTGTACAGGTGTCCTATAGGGA No data
Right 1049477486 8:142803537-142803559 TCCTGTAGGGGGTGCCCTGTAGG No data
1049477476_1049477482 3 Left 1049477476 8:142803498-142803520 CCTGTACAGGTGTCCTATAGGGA No data
Right 1049477482 8:142803524-142803546 TCCTGTAGGGGTGTCCTGTAGGG No data
1049477476_1049477490 30 Left 1049477476 8:142803498-142803520 CCTGTACAGGTGTCCTATAGGGA No data
Right 1049477490 8:142803551-142803573 CCCTGTAGGGAGTGTCCCGTAGG No data
1049477476_1049477488 17 Left 1049477476 8:142803498-142803520 CCTGTACAGGTGTCCTATAGGGA No data
Right 1049477488 8:142803538-142803560 CCTGTAGGGGGTGCCCTGTAGGG No data
1049477476_1049477479 -10 Left 1049477476 8:142803498-142803520 CCTGTACAGGTGTCCTATAGGGA No data
Right 1049477479 8:142803511-142803533 CCTATAGGGATCGTCCTGTAGGG No data
1049477476_1049477481 2 Left 1049477476 8:142803498-142803520 CCTGTACAGGTGTCCTATAGGGA No data
Right 1049477481 8:142803523-142803545 GTCCTGTAGGGGTGTCCTGTAGG No data
1049477476_1049477484 4 Left 1049477476 8:142803498-142803520 CCTGTACAGGTGTCCTATAGGGA No data
Right 1049477484 8:142803525-142803547 CCTGTAGGGGTGTCCTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049477476 Original CRISPR TCCCTATAGGACACCTGTAC AGG (reversed) Intergenic