ID: 1049477481

View in Genome Browser
Species Human (GRCh38)
Location 8:142803523-142803545
Sequence GTCCTGTAGGGGTGTCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049477476_1049477481 2 Left 1049477476 8:142803498-142803520 CCTGTACAGGTGTCCTATAGGGA No data
Right 1049477481 8:142803523-142803545 GTCCTGTAGGGGTGTCCTGTAGG No data
1049477472_1049477481 16 Left 1049477472 8:142803484-142803506 CCTGTAGGGGATATCCTGTACAG No data
Right 1049477481 8:142803523-142803545 GTCCTGTAGGGGTGTCCTGTAGG No data
1049477469_1049477481 30 Left 1049477469 8:142803470-142803492 CCTGTAGGGAGTGTCCTGTAGGG No data
Right 1049477481 8:142803523-142803545 GTCCTGTAGGGGTGTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049477481 Original CRISPR GTCCTGTAGGGGTGTCCTGT AGG Intergenic