ID: 1049477488

View in Genome Browser
Species Human (GRCh38)
Location 8:142803538-142803560
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049477478_1049477488 4 Left 1049477478 8:142803511-142803533 CCTATAGGGATCGTCCTGTAGGG No data
Right 1049477488 8:142803538-142803560 CCTGTAGGGGGTGCCCTGTAGGG No data
1049477476_1049477488 17 Left 1049477476 8:142803498-142803520 CCTGTACAGGTGTCCTATAGGGA No data
Right 1049477488 8:142803538-142803560 CCTGTAGGGGGTGCCCTGTAGGG No data
1049477483_1049477488 -10 Left 1049477483 8:142803525-142803547 CCTGTAGGGGTGTCCTGTAGGGG No data
Right 1049477488 8:142803538-142803560 CCTGTAGGGGGTGCCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049477488 Original CRISPR CCTGTAGGGGGTGCCCTGTA GGG Intergenic
No off target data available for this crispr