ID: 1049478240

View in Genome Browser
Species Human (GRCh38)
Location 8:142806804-142806826
Sequence AAGCTAAGCCTACCCTAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049478240_1049478244 -2 Left 1049478240 8:142806804-142806826 CCTGTCTAGGGTAGGCTTAGCTT No data
Right 1049478244 8:142806825-142806847 TTGGGCCAGTGGCAGAGCCAAGG No data
1049478240_1049478246 6 Left 1049478240 8:142806804-142806826 CCTGTCTAGGGTAGGCTTAGCTT No data
Right 1049478246 8:142806833-142806855 GTGGCAGAGCCAAGGTGCACAGG No data
1049478240_1049478249 15 Left 1049478240 8:142806804-142806826 CCTGTCTAGGGTAGGCTTAGCTT No data
Right 1049478249 8:142806842-142806864 CCAAGGTGCACAGGGCAGCCTGG No data
1049478240_1049478247 7 Left 1049478240 8:142806804-142806826 CCTGTCTAGGGTAGGCTTAGCTT No data
Right 1049478247 8:142806834-142806856 TGGCAGAGCCAAGGTGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049478240 Original CRISPR AAGCTAAGCCTACCCTAGAC AGG (reversed) Intergenic
No off target data available for this crispr