ID: 1049478243 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:142806814-142806836 |
Sequence | GTAGGCTTAGCTTGGGCCAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049478236_1049478243 | 3 | Left | 1049478236 | 8:142806788-142806810 | CCTTGGGGTGGTGTTGCCTGTCT | 0: 1 1: 0 2: 1 3: 29 4: 263 |
||
Right | 1049478243 | 8:142806814-142806836 | GTAGGCTTAGCTTGGGCCAGTGG | No data | ||||
1049478231_1049478243 | 21 | Left | 1049478231 | 8:142806770-142806792 | CCTGGAATGGTGCAGGCTCCTTG | No data | ||
Right | 1049478243 | 8:142806814-142806836 | GTAGGCTTAGCTTGGGCCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049478243 | Original CRISPR | GTAGGCTTAGCTTGGGCCAG TGG | Intergenic | ||