ID: 1049478247

View in Genome Browser
Species Human (GRCh38)
Location 8:142806834-142806856
Sequence TGGCAGAGCCAAGGTGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049478240_1049478247 7 Left 1049478240 8:142806804-142806826 CCTGTCTAGGGTAGGCTTAGCTT No data
Right 1049478247 8:142806834-142806856 TGGCAGAGCCAAGGTGCACAGGG No data
1049478236_1049478247 23 Left 1049478236 8:142806788-142806810 CCTTGGGGTGGTGTTGCCTGTCT No data
Right 1049478247 8:142806834-142806856 TGGCAGAGCCAAGGTGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049478247 Original CRISPR TGGCAGAGCCAAGGTGCACA GGG Intergenic
No off target data available for this crispr