ID: 1049478249 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:142806842-142806864 |
Sequence | CCAAGGTGCACAGGGCAGCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049478240_1049478249 | 15 | Left | 1049478240 | 8:142806804-142806826 | CCTGTCTAGGGTAGGCTTAGCTT | No data | ||
Right | 1049478249 | 8:142806842-142806864 | CCAAGGTGCACAGGGCAGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049478249 | Original CRISPR | CCAAGGTGCACAGGGCAGCC TGG | Intergenic | ||