ID: 1049479740

View in Genome Browser
Species Human (GRCh38)
Location 8:142816200-142816222
Sequence CACTGGAGGTGGCCCGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049479726_1049479740 12 Left 1049479726 8:142816165-142816187 CCATGCCTTGCTCCTGCAGGGCC No data
Right 1049479740 8:142816200-142816222 CACTGGAGGTGGCCCGGGAAGGG No data
1049479731_1049479740 0 Left 1049479731 8:142816177-142816199 CCTGCAGGGCCTACAGCTGGGGG No data
Right 1049479740 8:142816200-142816222 CACTGGAGGTGGCCCGGGAAGGG No data
1049479727_1049479740 7 Left 1049479727 8:142816170-142816192 CCTTGCTCCTGCAGGGCCTACAG No data
Right 1049479740 8:142816200-142816222 CACTGGAGGTGGCCCGGGAAGGG No data
1049479734_1049479740 -9 Left 1049479734 8:142816186-142816208 CCTACAGCTGGGGGCACTGGAGG No data
Right 1049479740 8:142816200-142816222 CACTGGAGGTGGCCCGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049479740 Original CRISPR CACTGGAGGTGGCCCGGGAA GGG Intergenic
No off target data available for this crispr